We narrowed to 28,976 results for: Tat
-
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTK41
Plasmid#236110PurposeExpresses the motor domain of rat KIF5C fused with SNAP tag and ALFA tag nanobodyDepositorInsertsTagsALFA tag nanobody, His tag, SNAP tag, and StrepII…ExpressionBacterialMutationC7S mutation is introduced. 1-430 aa is encoded.PromoterT7Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724D
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop2
Plasmid#169832PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids R1398 - S1407; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1 and Loop2
Plasmid#169833PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 and F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletions of amino acids R1398 - S1407 and F1366 …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Allosteric Domain
Plasmid#169835PurposeExpresses C-terminal flag-tagged CAD with substitution of allosteric domain F1308 - C1455 with a (GGGS)X3 linkerDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationSubstitution of amino acids F1308 - C1455 with a …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(38))-PGKpuro2ABFP-W
Plasmid#200481PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(38) (CXCR4 Human)
UseLentiviralAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-R272Q
Plasmid#214911Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationR272Q substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-E80K
Plasmid#214910Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationE80K substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-80-GFP
Plasmid#205182PurposeExpresses chimeric rat CENP-O with mouse CENP-O N-terminus; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O N terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-203-GFP
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-298-GFP
Plasmid#205184PurposeExpresses chimeric rat CENP-O with mouse CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O C-terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENP-O-R298-GFP
Plasmid#205185PurposeExpresses chimeric mouse CENP-O with rat CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric mouse CENP-O with rat CENP-O C-terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (1-416) (K57A)
Plasmid#197124PurposeExpression of kinase-deficient Myc-tagged PSK2 (aa1-416, K57A) / TAOK1 (aa1-416, K57A) in mammalian cellsDepositorInsertTAOK1 (aa1-416, K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to A and deleted C-terminusPromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
K-to-R mutant NPRL3(1-569) in pLJM60, codon-optimized
Plasmid#184563PurposeCMV-driven expression of an untagged mutant NPRL3 (core subunit of GATOR1) — codon-optimized sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.DepositorInsertC16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11 (NPRL3 Human)
UseLentiviralExpressionMammalianMutationAll lysines were mutated to arginines. Codon-opti…PromoterCMVAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-NF1144AA-shRNAres_W
Plasmid#147898PurposeMammalian Expression of HsNot1iso1-del1097-1110-NF1144AA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-NF1144AA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-R1138A-shRNAres_W
Plasmid#147899PurposeMammalian Expression of HsNot1iso1-del1097-1110-R1138A-shRNAresDepositorInsertHsNot1iso1-del1097-1110-R1138A-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.337T>C-Flag
Plasmid#169169PurposeExpresses EPHX1 c.337T>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.337T>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.416A>G-Flag
Plasmid#169170PurposeExpresses EPHX1 c.416A>G in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsflagExpressionMammalianMutationc.337T>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.997A>C-Flag
Plasmid#169171PurposeExpresses EPHX1 c.997A>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.997A>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.1212G>C-Flag
Plasmid#169172PurposeExpresses EPHX1 c.1212G>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.1212G>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.1288G>C-Flag
Plasmid#169173PurposeExpresses EPHX1 c.1288G>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.1288G>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only