We narrowed to 177 results for: Hrg
-
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger1-TS-YFP)
Plasmid#127245PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger3-TS-YFP)
Plasmid#127242PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTag4C_Nrg1-GV-2HA
Plasmid#227104PurposeNrg1 protein for luciferase and barcode assaysDepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hNRG1a
Plasmid#199235PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-NRG1-ScNeo
Plasmid#209906PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa:polyA
Plasmid#193012PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neuronsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-NRG1-ScNeo
Plasmid#209911PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa_R551Q:polyA
Plasmid#193013PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa R551Q patient variant in neuronsDepositorInsertsUseTransposon transgenesisExpressionMammalianMutationENST00000287842, NM_013956, c.1652G>A, p.(Arg5…Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC48A1
Plasmid#132156PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC48A1 (SLC48A1 Human)
ExpressionMammalianAvailable SinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC48A1_STOP
Plasmid#161322PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC48A1 (SLC48A1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NRG1-COMP5AP-AviTag-9xHis
Plasmid#157230PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NRG1-Fc(DAPA)-AviTag-6xHis
Plasmid#156666PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNRG1 (NRG1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neuregulin-HBD (Heparin binding domain, Type I/II) [N120A/9.1R]
Plasmid#114507PurposeMammalian Expression Plasmid of anti-Neuregulin-HBD (Heparin binding domain, Type I/II) (Human). Derived from hybridoma N120A/9.1.DepositorInsertanti-Neuregulin-HBD (Heparin binding domain, Type I/II) (Homo sapiens) recombinant mouse monoclonal antibody (NRG1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Neuregulin-CRD (Cysteine-rich domain, Type III) scFv [N126B/31]
Plasmid#190528PurposeMammalian Expression of Neuregulin-CRD (Cysteine-rich domain, Type III) scFV. Derived from hybridoma N126B/31.DepositorInsertNeuregulin-CRD (Cysteine-rich domain, Type III) (Homo sapiens) recombinant scFV (NRG1 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neuregulin-CRD [N126B/31-2b] - Chimeric
Plasmid#227030PurposeMammalian expression plasmid of anti-Neuregulin-CRD (Cysteine-rich domain, Type III) (Human). Derived from hybridoma N126B/31.DepositorInsertAnti-Neuregulin-CRD (Cysteine-rich domain, Type III) (Homo sapiens) recombinant mouse monoclonal antibody. (NRG1 Mouse)
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only