We narrowed to 1,094 results for: proc.2
-
Plasmid#72217Purposebacterial expression of GST-tagged human Dcp2 Q147/8 mutant (disrupts the decapping function of Dcp2)DepositorInsertDcp2 (DCP2 Human)
TagsGSTExpressionBacterialMutationE147Q, E148Q and F404L (please see depositor'…PromotertacAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMyc2ElbLuc,
Plasmid#53244Purposereporter plasmid containing 2 myc cDNA binding sitesDepositorInsertpMyc2ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fou…Available SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-hDcr-K70A.
Plasmid#89145PurposeExpression of helicase mutant of human Dicer in Sf9 cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1_OCT4_T234E_S235E
Plasmid#40635DepositorInsertPOU5F1 (POU5F1 Human)
TagsGST, TEV Cleavage, and Thrombin CleavageExpressionBacterialMutationT234E_S235EPromotertacAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1_OCT4_T234E
Plasmid#40636DepositorInsertPOU5F1 (POU5F1 Human)
TagsGST, TEV Cleavage, and Thrombin CleavageExpressionBacterialMutationT234EPromotertacAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1_OCT4_T234A
Plasmid#40637DepositorInsertPOU5F1 (POU5F1 Human)
TagsGST, TEV cleavage, and Thrombin cleavageExpressionBacterialMutationT234APromotertacAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1_OCT4_S235E
Plasmid#40638DepositorInsertPOU5F1 (POU5F1 Human)
TagsGST, TEV Cleavage, and Thrombin CleavageExpressionBacterialMutationS235EPromotertacAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1_OCT4_S235A
Plasmid#40639DepositorInsertPOU5F1 (POU5F1 Human)
TagsGST, TEV Cleavage, TEV cleavage, Thrombin Cleavag…ExpressionBacterialMutationS235APromotertacAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
3625 pSP72 Bim (genomic)
Plasmid#8805DepositorInsertBim genomic (Bcl2l11 Mouse)
ExpressionBacterialAvailable SinceJuly 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ARIH2 binding E2 variant L3A2-5
Plasmid#248848PurposeN-term GST tag E2 variant selected for ARIH2DepositorInsertGST-L3A2-5
TagsAvi and GSTExpressionBacterialAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ARIH2 binding E2 variant D3A2-1
Plasmid#248849PurposeN-term GST tag E2 variant selected for ARIH2DepositorInsertGST-D3A2-1
TagsAvi and GSTExpressionBacterialAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ARIH2 binding E2 variant L3A2-3
Plasmid#248586PurposeN-term GST tag E2 variant selected for activated ARIH2DepositorInsertpGEX-GST-L3A2-3
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ARIH1 binding E2 variant L3A1-1
Plasmid#248587PurposeN-term GST tag E2 variant selected for activated ARIH1DepositorInsertpGEX-GST-L3A1-1
TagsAvi and GSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag RNF14 binding E2 variant L3R14-1
Plasmid#248589PurposeN-term GST tag E2 variant selected for RNF14DepositorInsertpGEX-GST-L3R14-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ARIH2 binding E2 variant L3A2-4
Plasmid#248847PurposeN-term GST tag E2 variant selected for ARIH2DepositorInsertGST-L3A2-4
TagsAvi and GSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag CUL9 binding E2 variant L3C9-1
Plasmid#248851PurposeN-term GST tag E2 variant selected for CUL9DepositorInsertGST-L3C9-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-tag ANKIB1 binding E2 variant L3AN-1
Plasmid#248852PurposeN-term GST tag E2 variant selected for ANKIB1DepositorInsertGST-L3AN-1
TagsGSTExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHsp70(K71E)-GFP
Plasmid#228196Purposeexpressed human Hsp70 (K71E mutation) with a GFP fluorescent protein tagDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only