We narrowed to 9,760 results for: CAG
-
Plasmid#249225PurposePTPRD CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-hNRP2-gRNA3
Plasmid#249215PurposeNRP2 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNRP2-gRNA2
Plasmid#249214PurposeNRP2 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNRP2-gRNA1
Plasmid#249213PurposeNRP2 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNRP1-gRNA3
Plasmid#249212PurposeNRP1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shDLD #2
Plasmid#242707PurposeshRNA knockdown human DLD geneDepositorInsertDLD (DLD Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-hSyncytin-1(AAAR)
Plasmid#182442PurposehSyncytin-1, furin cleavage site RNKR>AAAR(314-317)DepositorInsertERVW-1 (ERVW-1 Human)
ExpressionMammalianMutationfurin cleacage site RNKR>>AAAR(314-317)PromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway CloningMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pKLV-gRNA-BTRC-MGMT_2
Plasmid#136416PurposeLentiviral expression of gRNAs targeting intron 2 of human BTRC and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(BTRC)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDLX4.1.0-gDNA
Plasmid#132437PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertDLX4 (DLX4 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF700.1.0-gDNA
Plasmid#112481PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF700DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF169.2.0-gDNA
Plasmid#112472PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF169DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF227.1.0-gDNA
Plasmid#112464PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF227DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTX1.1.0-gDNA
Plasmid#112460PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor OTX1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
alpha4-nAChR shRNA (Alpha-4.3)
Plasmid#86652Purposeexpression of shRNA targeting CHRNA4DepositorAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only