We narrowed to 7,184 results for: RAP
-
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB Ubiqutin-BFP
Plasmid#202426PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domain fused to ubiquitinDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsUbiquitin, TagBFPExpressionMutationPromoterAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT-RP2.2
Plasmid#189842PurposeIntron-based gene-break transposon (GBT) for an effective and revertible loss-of-function tool for zebrafish. Ubiquitous GFP frameshift 2.DepositorTypeEmpty backboneUseCre/LoxTagsGFP GM2 variant and mRFPExpressionMutationPromoterbeta ActinAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT-RP2.3
Plasmid#189843PurposeIntron-based gene-break transposon (GBT) for an effective and revertible loss-of-function tool for zebrafish. Ubiquitous GFP frameshift 3.DepositorTypeEmpty backboneUseCre/LoxTagsGFP GM2 variant and mRFPExpressionMutationPromoterbeta ActinAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT-RP8.3
Plasmid#189848PurposeIntron-based gene-break transposon (GBT) for an effective and revertible loss-of-function tool for zebrafish. Lens tagBFP frameshift 3.DepositorTypeEmpty backboneUseCre/LoxTagsmRFP and tagBFPExpressionMutationPromoterbeta ActinAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET303C-hSOD1 A4V/C6S
Plasmid#139667PurposeExpression plasmids containing human A4V/C6S SOD1DepositorInsertSuperoxide dismutase-1 (SOD1 Human)
UseTagsExpressionBacterialMutationchange alanine 4 to valine, change cysteine 6 to …PromoterT7Available sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c029
Plasmid#175471PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R and H288A point mutations that reduce binding to CD44.DepositorInsertMSN (MSN Human)
UseTagsHis6-TEVExpressionBacterialMutationL281R, H288APromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-YAPL318E
Plasmid#166444PurposeBacterial expression of 6x His tagged YAPL318EDepositorInsertYAPL318E (YAP1 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-YAP4LE
Plasmid#166445PurposeBacterial expression of 6x His tagged YAP4LEDepositorInsertYAP4LE (YAP1 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
S1 1029 CP APOBEC3 no UGI
Plasmid#135352PurposeExpression of circular permutant of nSpyCas9 lacking uracil DNA glycosylase inhibitor at amino acid position 1029 encoding rat cytosine deaminase, rAPOBEC3 at the N-terminusDepositorInsertrAPOBEC3-nSpyCas9 aa 1029
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 C264A
Plasmid#129293PurposeGateway entry clone encoding human ATG3 C264A (catalytic inactive)DepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationchanged Cysteine 264 to AlaninePromoterAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 allKR
Plasmid#129295PurposeGateway entry clone encoding human ATG3 with all 22 lysine residues mutated to arginineDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationchanged all 22 Lysine residues to ArgininePromoterAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 allKR
Plasmid#129298PurposeExpresses pCMV 3xFLAG-ATG3 allKR (all lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseTags3xFLAGExpressionMammalianMutationchanged all 22 Lysine residues to ArgininePromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 1-13 KR
Plasmid#129299PurposeExpresses pCMV 3xFLAG-ATG3 1-13 KR (first thirteen lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseTags3xFLAGExpressionMammalianMutationchanged first 13 Lysine residues to ArgininePromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 14-22 KR
Plasmid#129300PurposeExpresses pCMV 3xFLAG-ATG3 14-22 KR (last nine lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseTags3xFLAGExpressionMammalianMutationchanged last 9 Lysine residues to ArgininePromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 K295R
Plasmid#129302PurposeExpresses pCMV 3xFLAG-ATG3 K295R in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseTags3xFLAGExpressionMammalianMutationchanged Lysine 295 to ArgininePromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only