We narrowed to 6,580 results for: kit
-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianPromoterU6 for sgRNA and CBh for dCas9Available SinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Neo)
Plasmid#140645PurposeCTCF tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMIG-FLAG-MLL-AF9
Plasmid#71443PurposeRetroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-GFPDepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FBXO22
Plasmid#232271PurposeExpression of N-terminal tagged HA-FBXO22 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMIR-FLAG-MLL-AF9
Plasmid#71444PurposeRetroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-dsRed Express2DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 WT
Plasmid#53446PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationsiRNA resistant and mutations A128V, T720A, A1347…Available SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLPB2B-FKBP12_F36V-hHDAC4-SpdCas9-tagBFP-PGK-Blasticidin
Plasmid#187956PurposeFKBP12 (F36V mutant) degron-tagged hHDAC4-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-hHDAC4-SpdCas9-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-KRAB-SpdCas9-tagBFP-PGK-Blasticidin
Plasmid#187957PurposeFKBP12 (F36V mutant) degron-tagged KRAB-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-KRAB-SpdCas9-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLAG-BACH2
Plasmid#232275PurposeExpression of FLAG-tagged BACH2 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-BACH1
Plasmid#232269PurposeExpression of N-terminal tagged HA-BACH1 (H. sapiens) in human cell lines.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only