We narrowed to 824 results for: gcat
-
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6 and hU6-2xTetOAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta human (DGKZ Human)
UseRNAiTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta human (GTPBP6 Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX3X-ts2
Plasmid#174236PurposeDDX3X knockdownDepositorInsertDDX3X shRNA (DDX3X Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro FLVCR1_sg5
Plasmid#218522PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v1 GFP FLVCR1_sg5
Plasmid#218521PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shTAL1
Plasmid#210640PurposeKnockdown of TAL1 endogenous (3'UTR)DepositorInsertTAL1 3' UTR gRNA (TAL1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA1
Plasmid#201588PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCct8 - 1
Plasmid#198503Purposelentiviral stable expression of mCct8 gRNA 1DepositorInsertmCct8 (Cct8 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPrdm9#1/Cre
Plasmid#193231PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Prdm9 geneDepositorInsertsgPrdm9#1 (Prdm9 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgStag2#1/Cre
Plasmid#173659PurposeExpresses a Stag2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Stag2 (Stag2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only