We narrowed to 15,831 results for: grna
-
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only
-
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_APL3
Plasmid#166073PurposePlasmid for constituive spCas9 and tet-inducible APL1-targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
UCT1m
Plasmid#121041PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertUCT-part guide RNA (Stanley Qi sequence)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRTagsExpressionPlantMutationPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS9i_TRP
Plasmid#141253PurposeGalactose-inducible expression of Cas9 for addressing one target; Contains guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterGAL1 (Cas9), pSNR52 (gRNA)Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PCNA
Plasmid#188686Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-shATF4 #2
Plasmid#242703PurposeshRNA knockdown human ATF4 geneDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #1
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #1
Plasmid#242702PurposeshRNA knockdown human ATF4 geneDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6:2-U6:3-tevopreq1
Plasmid#190910PurposeExpression of nicking sgRNA and epegRNA under control of separate Drosophila U6:2 and U6:3 promoters. Can be used to generate transgenic flies with vermillion+ selection.DepositorInsertEmpty Backbone
UseCRISPRTagsExpressionInsectMutationPromoterAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK5-g5g6-K6
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMETTL16-2-Hygromycin
Plasmid#196200Purposeknockout METTL17DepositorAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only