We narrowed to 44,914 results for: cha
-
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cx32R220stop
Plasmid#78151PurposeMammalian Expression of the first 219 amino acids of Connexin 32 and EGFP from a bicistronic mRNADepositorInsertConnexin 32 (GJB1 Human)
TagsEGFPExpressionMammalianMutationOnly contains first 219 residuesPromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MTS-KD-c-Src-FLAG
Plasmid#44653DepositorInsertv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC) (SRC Human)
TagsFLAG tag and mitochondria-targeting sequence (MTS…ExpressionMammalianMutationchanged lysine 298 to methioninePromoterCMV promoterAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
YA1531: pAAV_CAG-FLEX-QuasAr3
Plasmid#107701Purposein vivo voltage imagingDepositorInsertQuasAr3
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nsp14-mCherry
Plasmid#165137Purposemammalian expression and localizationDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330 Rosa26 AscI LH291Gu1 (LH500)
Plasmid#99628PurposePlasmid used to target the pre-modified Rosa26 allele with Cas9DepositorInsertCas9
UseCRISPRTags3xFLAGAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
px330 Rosa26 Gu1 (LH416)
Plasmid#99629PurposePlasmid used to target the wildtype Rosa26 allele with Cas9DepositorInsertCas9
UseCRISPRAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Cdx2-3xT7
Plasmid#200891PurposeInducible lentiviral expression of Cdx2DepositorInsertCdx2 (Cdx2 Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-MYH10
Plasmid#183869PurposeRepair template for the N-terminal tagging of myosin heavy chain 10 with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertMYH10 homology arms with mRuby2-linker (MYH10 Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human _TFAM_NoMTS_Dimer_pET28a+
Plasmid#60013PurposeExpresses TFAM No MTS dimerization mutant in bacterial cellsDepositorInsertHuman TFAM No MTS (TFAM Human)
Tags6xHisExpressionBacterialMutationMissing 1st 42 aas (Mitochondrial targeting seque…PromoterT7Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
YA1629: pAAV_CAG-FLEX-paQuasAr3-s
Plasmid#107703Purposein vivo voltage imagingDepositorInsertpaQuasAr3
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
YA1627: pAAV_hSyn-Dio-paQuasAr3-s-P2A-CheRiff-s
Plasmid#107704Purposein vivo voltage imagingDepositorInsertpaQuasAr3-P2A-CheRiff
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/Nuc-mutant-hogg1
Plasmid#18710DepositorInsert8-oxoguanine DNA glycosylase (OGG1 Human)
ExpressionMammalianMutationAmino Acid 229 Arginine changed to GlutamineAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE4RA-P2A-Puro
Plasmid#112672PurposeLentivirus for constitutive expression of BE4RA in mammalian cells (codon optimized)DepositorInsertBE4RA
UseLentiviralTagsFLAGMutationNLS sequence at the N-terminus and D10APromoterEF1sAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Nsp8
Plasmid#165114Purposemammalian expression and localizationDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only