We narrowed to 7,184 results for: RAP
-
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorUseAAVTagsExpressionMutationPromoterhSynAvailable sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pX330-TP53-2
Plasmid#121918PurposeEncodes sgRNA targeting exon 9 of TP53DepositorInsertTP53 (TP53 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…TagsExpressionMammalianMutationPromoterCMV/Chick β-actin (CAG)Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorInsertLgBiT-hACE2-IgG1 Fc (ACE2 Human)
UseLuciferaseTagsIgG1ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIG-804_HA-GD2-28z_CAR_BATF-TFAP4
Plasmid#207491PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-TFAP4, HA-GD2-28z_CAR (BATF Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterEf1aAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-pGC-A
Plasmid#186626PurposepFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)DepositorInsertNPR1 (NPR1 Human)
UseTagshemagglutinin (HA) signal peptide + His10-tag + T…ExpressionInsectMutationdeleted amino acids 1-32PromoterpolyhedringAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-PuroR [M1G]
Plasmid#171800PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-PuroR
UseGene taggingTagsExpressionMutationPuroR: Changed Methionin 1 to Glycine.PromoterAvailable sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP12-5ptpase domain
Plasmid#67516PurposeRecruitable human type IV 5-phosphatase domain (214-644)DepositorUseTagsmRFPExpressionMutationINPP5E has C641A to destroy the C-terminal CAAX d…PromoterAvailable sinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Human, Synthetic)
UseTagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-BlastR [M1G]
Plasmid#171805PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-BlastR
UseGene taggingTagsExpressionMutationBlastR: Changed Methionin 1 to Glycine.PromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIG-835_NY-ESO-1_TCR_FAS/MyD88
Plasmid#207498PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/MyD88, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only