We narrowed to 15,833 results for: grna
-
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-1
Plasmid#118019PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-3
Plasmid#118021PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-5
Plasmid#118023PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 3 sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-Malat1
Plasmid#216858PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing Malat1 at the synapse. CIRTS-YTHDF2-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-Malat1 gRNA
UseLentiviralTagsGFPExpressionMammalianMutationPromoterSyn1, U6Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh
Plasmid#159901PurposeMutagenesis of ThDepositorAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-tTRKRAB-red
Plasmid#12250DepositorInsertTetR-KRAB fusion and dsRED
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationdsRed added to backbone.PromoterAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBFv-U6.2
Plasmid#138400PurposegRNA expression vector for DrosophilaDepositorTypeEmpty backboneUseTagsExpressionInsectMutationPromoterU6-2Available SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
hCtRNA_FT
Plasmid#186715PurposeFragment template for DAP arrayDepositorInsertgRNA scaffold and hCtRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhCtRNAAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCtRNA_VT
Plasmid#186716PurposeVector template for DAP arrayDepositorInserthCtRNA and gRNA scaffold
UseCRISPRTagsExpressionMammalianMutationPromoterhCtRNAAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
TMEM165 g2 LentiCRISPRv2-mCherry
Plasmid#218661PurposeKnockout vector for human TMEM165DepositorInsertTMEM165 (TMEM165 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
shGFP neo
Plasmid#72571PurposeHairpin targeting GFP.DepositorInsertGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSICO-Flpo
Plasmid#24969DepositorInsertFlp recombinase
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVTH-siGFP
Plasmid#12248DepositorInsertshRNA against GFP
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationNGFRdel is in place of GFP on the backbone.PromoterAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only