We narrowed to 25,321 results for: Spr
-
Plasmid#75606Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CDKL3 gRNA (BRDN0001148623)
Plasmid#75607Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA1 gRNA (BRDN0001147142)
Plasmid#75590Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMKV gRNA (BRDN0001162273)
Plasmid#75529Purpose3rd generation lentiviral gRNA plasmid targeting human CAMKVDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146170)
Plasmid#75538Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146284)
Plasmid#75539Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR2B gRNA (BRDN0001147208)
Plasmid#75485Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR2B gRNA (BRDN0001149036)
Plasmid#75486Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IPMK gRNA (BRDN0001144988)
Plasmid#78076Purpose3rd generation lentiviral gRNA plasmid targeting human IPMKDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHKA gRNA (BRDN0001145792)
Plasmid#76586Purpose3rd generation lentiviral gRNA plasmid targeting human CHKADepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
CLK4 gRNA (BRDN0001145430)
Plasmid#77797Purpose3rd generation lentiviral gRNA plasmid targeting human CLK4DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
CLK4 gRNA (BRDN0001146113)
Plasmid#77798Purpose3rd generation lentiviral gRNA plasmid targeting human CLK4DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
IP6K2 gRNA (BRDN0001146075)
Plasmid#77816Purpose3rd generation lentiviral gRNA plasmid targeting human IP6K2DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only