We narrowed to 23,460 results for: c-myc
-
Plasmid#186573PurposeExpression of "dark MitoTrap" - an FRB-domain targeted to the mitochondria that is the same size as pMito-mCherry-FRB but is non-fluorescent - in human cellsDepositorInsertDark MitoTrap
ExpressionMammalianMutationMutation of "K70N" to render mCherry no…PromoterCMVAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-LEU2
Plasmid#157656PurposeGFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequenceDepositorInsertGFP-gRNA
UseInsert storage (replicative in e. coli)TagsGFP-gRNAAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_empty_gRNA
Plasmid#197557Purposesites for cloning two gRNA with puromycin cassetteDepositorTypeEmpty backboneUseEmpty grna backbone with puromycin resistance geneExpressionMammalianPromoterU6 for gRNA, CMV for puromycin resistance.Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGLTR-X-PURO
Plasmid#58246PurposeGATEWAY-compatible lentiviral conditional RNAi delivery vector; SFFV-driven expression of TetR and Puromycin selectionDepositorInsertPuro(R)
UseLentiviral and RNAi; Gateway destionation vectorTagsTetR-NLS-T2AExpressionMammalianPromoterSFFVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTJK512
Plasmid#121469PurposeCEN LEU2 CNB1DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK502
Plasmid#121457PurposeCEN HIS3 CNB1DepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK518
Plasmid#121475PurposeCEN TRP1 CNA1ΔAIDDepositorInsertCNA1deltaAID
UseYeast cen vectorMutationTruncated after amino acid 508PromoterEndogenous genomic promoter regionAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK519
Plasmid#121476PurposeCEN TRP1 CNA1ΔCBDDepositorInsertCNA1deltaCBD
UseYeast cen vectorMutationTruncated after amino acid 453PromoterEndogenous genomic promoter regionAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
Cas12aUltra_5XNLS
Plasmid#218775PurposeHis-TEV-Cas12aUltra-BPSV40_cMyc_NP_5NLSDepositorInsert5xNLS-BPSV40-NLP-cMyc-cMyc-BPSV40- AspCas12a
UseCRISPRTags6XHis (C terminal), HA, Nucleoplasmin, SV40, and …ExpressionBacterialMutationNucleotides mutations were made to encode for arg…Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -