We narrowed to 24,044 results for: fus
-
Plasmid#169510PurposeTier-1 vector encoding PhCMV-driven green fluorescent protein turbo GFP (PhCMV-tGFP-pA).DepositorInsertPCMV-driven turbo green fluorescent protein
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pYC25
Plasmid#63914PurposeRecipient overexpressing vector to construct YFP tagged fusionsDepositorTypeEmpty backboneTagsYFPExpressionYeastPromoterTEF1 (Saccharomyces cerevisiae)Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDS1U-PKS12
Plasmid#70150PurposeFusarium graminearum PKS12 encoded on CEN/ARS yeast shuttle vector with DS1U selection markerDepositorAvailable SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYC16
Plasmid#63913PurposeRecipient overexpressing vector to construct CFP tagged fusionsDepositorTypeEmpty backboneTagsCFPExpressionYeastPromoterTEF1 (Saccharomyces cerevisiae)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CpcB•PHLS+Cpc
Plasmid#73335PurposeExpresses the PHLS gene as a fusion with the CpcB gene followed by the CmR geneDepositorInsertcpcB•PHLS-CmR
Promotercpc operonAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TO-CasRx(NLS)-T2A-mCherry
Plasmid#242433PurposeCasRx (NLS-RfxCas13d-NLS) for RNA targeting under the CMV-TO promoter (CMV with two Tet-Operators)DepositorInsertCasRx
UseCRISPRTagsTag / Fusion Protein: T2A mCherryAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI_JUNO_GFPnes
Plasmid#240499PurposeCell fusion assaysDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-NanA-CSS-ET64
Plasmid#234666PurposeExpression an ELP-tagged fusion enzyme of NanA and CSSDepositorInsertssialic acid aldolase
CMP-sialic acid synthetase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-ManC-NahK-ET64
Plasmid#234664PurposeExpression an ELP-tagged fusion enzyme of PfManC and NahKDepositorInsertsGDP-Man pyrophosphorylase
N-acetylhexosamine 1-kinase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF_AfRbcLS
Plasmid#229518PurposeExpresses Anthoceros fusiformis Rubisco large and small subunit (C terminus hexahistidine)DepositorInsertsRubisco large subunit
Rubisco small subunit
TagshexahistidineExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-d22bp
Plasmid#235657PurposeB. thetaiotaomicron fusA2 expression reporter lacking 22bp Cur binding siteDepositorInsertBacteroides thetaiotaomicron fusA2 promoter lacking the 22bp Cur binding site
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSNRW-Z3-Nluc
Plasmid#174486PurposeRecombinant fusion protein gene combining IgG-Fc binding domain Z (3 repeats) of Staphylococcal Protein A and bioluminescence reporter Nanoluciferase in pET28a bacterial expression plasmid.DepositorInsertZ3-Nluc
Tags6x Histidine tagExpressionBacterialPromoterT7lac promoterAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2369-Tier1-PhCMV_KRAB
Plasmid#169571PurposeTier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).DepositorInsertPCMV-driven Kruppel associated box domain
ExpressionMammalianPromoterPhCMVAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2341_Tier3(SB)-Puro
Plasmid#169639PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH228-Tier1-OVanO2-PCMVmin2-SEAP
Plasmid#169564PurposeTier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).DepositorInsertvanillic acid-controlled SEAP production
ExpressionMammalianPromoterVanO2-PCMVminAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH1001-Tier2(ColE1 ori)
Plasmid#169599PurposeTier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2351_Tier3(SB)-Zeo
Plasmid#169648PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a ZeoR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-ZeoR-pA-3'ITR)DepositorInsertPRPBSA-driven ZeoR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only