We narrowed to 27,162 results for: RON
-
Plasmid#72191PurposeExpress full-length Flrt1 with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-Ef1a-Coff/Fon-BFP
Plasmid#137131PurposeIntersectional viral expression of BFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-BFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-oScarlet
Plasmid#137137PurposeIntersectional viral expression of oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-sRGECO
Plasmid#137127PurposeIntersectional viral expression of sRGECO in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGK-HA-PGRN-LAMP1TM
Plasmid#234873PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterPGKAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.CMV/Flag-NCOA7 variant 6.IRES-puro.WPRE (CG494)
Plasmid#139447PurposeLentiviral vector to ectopically express human NCOA7 isoform 4 from CMV promoterDepositorInsertFLAG-tag NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1584
Plasmid#121055PurposeYPET^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertYPET^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized YPET, and auxi…ExpressionWormAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-Fc-His
Plasmid#72075PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRepair-mScI-CTNNB1
Plasmid#153431PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mScarlet-iDepositorInsertCTNNB1 homology arms and mScI coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmScarlet-iAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Synthetic, Human)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-oScarlet
Plasmid#137138PurposeIntersectional viral expression of oScarlet in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.SFFV/Flag-NCOA7 variant 6.IRES-puro.WPRE (CG536)
Plasmid#139443PurposeLentiviral vector to ectopically express human NCOA7 isoform 4 from SFFV promoterDepositorInsertFLAG-tag NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterSFFVAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_BbsI-gRNA scaffold-EC73-5'-EcoRI-EC73-3'-HDV_pA_pCMV_EGFP-L202S-P2A-mCherry_pA
Plasmid#176461PurposeVector for constructing retron Ec73ncRNA-gRNA chimeric RNA (Ec73 rgRNA), inserting spacer sequence by BbsI digestion and inserting donor sequence by EcoRI digestion. EGFP(L202S)-P2A-mCherry driven by CMVDepositorInsertBbsI-gRNA scaffold-Ec73ncRNA-EcoRI-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-BoNT/B(1-146)-iLID
Plasmid#122982PurposeAAV plasmid with human synapsin promoter driving mCh and BoNT/B amino acids 1-146 fused to iLID(V416I), separated with an IRES element. Co-express with SSPB-BoNT(147-441, Y365A) for sPA-BoNTDepositorInsertmCh-IRES-BoNT/B(1-146)-iLID
UseAAVTagsmChExpressionMammalianMutationiLID contains long lived V416I mutationPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only