We narrowed to 6,639 results for: itch
-
Plasmid#164779Purposecysteine mutated nAChR beta2 subunit (E61C) for the attachment of a photoswitchable tethered ligandDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pPHR-mCherry-hHP1β
Plasmid#103830PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
BAP1-010
Plasmid#68366Purposestable expression of BAP1 delta 221-238 in mammalian cellsDepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationdelta 221-238, splice variant found in human meso…PromoterCMVAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 124A/125A
Plasmid#164523PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions R124A/K125A)DepositorInsertNSP1 124A/125A (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-tdTomato-Raf1
Plasmid#104176PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with tdTomato and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-mCherry-Raf1
Plasmid#104066PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-FLAG-STIM1(238-685)
Plasmid#248299PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterCamKllaAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-EGFP-CRY2-STIM1(318-450)
Plasmid#248302PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-FLAG-STIM1(238-685)
Plasmid#248301PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER, G108V)
Plasmid#233344PurposeStable expression of EGFP-LOV2(N538E)-BAX(G108V)-Cyb5a in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationBAX(3-171), N-terminus and C-terminus are deleted…Available SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-Lbr-V5-mCherry
Plasmid#235093PurposeLbr mCherry fusion protein with MCP domainDepositorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(lyso, G108V)
Plasmid#233345PurposeStable expression of EGFP-LOV2(G528A, N538E)-BAX-TMEM106B in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationBAX(3-171), N-terminus and C-terminus are deleted…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc LifeactΔC4-msfGFPΔN7
Plasmid#231555PurposeMammalian expression of C-terminally truncated Lifeact fused to N-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mRuby-Rab35
Plasmid#194334PurposeFor use in light-induced Rab35 protein inactivation through the interaction with CRY2DepositorTagsmRubyExpressionMammalianPromoterCMV IE94Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-YTH-mCherry-Cry2
Plasmid#177126PurposeExpress YTH domain fragment of YTHDC1 with mCherry and CRY2 tag for Optodroplet AssayDepositorInsertYTHDC1 (YTH domain) (YTHDC1 Human)
TagsmCherry-CRY2ExpressionMammalianMutationYTH domain onlyPromoterSFFVAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hGCN5mut
Plasmid#103828PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorExpressionMammalianMutationhGCN5: A566G (E189G), G585T (K195N), G726A (silen…PromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only