We narrowed to 13,996 results for: eng
-
Plasmid#169336PurposeExpression of the LT-Fucci(SA) in mammalian cellsDepositorTagsHaloTag7-Geminin(1/110) and HaloTag9-Cdt(30-120)ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only
-
(369) pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)
Plasmid#168190PurposeHA-tagged GFP nanobody Lag6 (310 nM affinity) fused to a truncated OGA with residues 544-706. For use with myc-OGA(1-400) split-OGA system.DepositorInsertHA-nLag6-(EAAAK)4-OGA(544-706)
TagsHA-TagExpressionMammalianPromoterT7/CMVAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT25_GalL_BE3
Plasmid#143736PurposeExpresses BE3 in yeast cellsDepositorInsertBE3
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgH-8his (Merlin)
Plasmid#136447PurposeMammalian expression plasmid for HCMV glycoprotein H (Merlin strain) extracellular domain with 8his purification tagDepositorInsertglycoprotein H (UL75 Human betaherpesvirus 5)
TagsShort GGSG linker and 8his tagExpressionMammalianMutationExtracellular domain (a.a. 1-716). Codon-optimize…PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Col7A1-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124287PurposesgRNA against human Col7A1DepositorInsertCollagen type VII alpha 1 chain (COL7A1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-LIC1 G domain
Plasmid#74602Purposeexpresses LIC1 in mammalian cells; aa 1-389, untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 amino acids 1-389 (DYNC1LI1 Human)
UseLentiviralTagsHA tagExpressionMammalianPromoterSFFVAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-SIN-GFP-PTEN-R11A
Plasmid#30540DepositorAvailable SinceAug. 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-G139S
Plasmid#24581DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationGlycine 139 changed to serine (codon GGT to AGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-S437R
Plasmid#24582DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationSerine 437 changed to Arginine (codon AGT to CGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-HSF1-VIRF2
Plasmid#218557PurposeEncodes SFFV promoter-driven MCP-HSF1-VIRF2 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-HSF1-VIRF2
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3A-3xFLAG
Plasmid#109213PurposeEncodes human full-length SIN3A with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-YAP5SA-3xMIR122
Plasmid#223186PurposePlasmid containing the Zfr/YAP5SA/3xMIR122 cassette. Translation of YAP5SA is controlled by splicing modulation of the Zfr specifically in cardiomyocytes by risdiplam in vivo.DepositorUseAAVTagsHA and engineered P2AMutationS61A, S109A, S127A, S164A, S381APromoterTNNT2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro CCND2-T2A-luciferase-P2A-eGFP
Plasmid#179843PurposeTunable and temporal expression control of CCND2, luciferase and nuclear eGFPDepositorInsertCCND2 (CCND2 Human)
UseLuciferase and Synthetic BiologyTagseGFP and luciferaseExpressionMammalianPromoterTRE3GAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-SaKKH-spA-miniU6-miniSdd6-MmHPD-T2
Plasmid#204852PurposeAAV vector for cytosine base editing using miniSdd6 at HPD-T2 target site in mouseDepositorInsertminiSdd6-nSaCas9KKH(D10A)-UGI
UseAAV and CRISPRMutationD10A, E782K, N968K, R1015H in SaCas9PromoterEFS, miniU6Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-plk1-AKAP
Plasmid#132967PurposeTo study the processes involved in early mitotic events, mitotic progression, and control of re-entry after DNA damageDepositorExpressionMammalianMutationC terminus of full-length Plk1 fused to the peric…Available SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only