We narrowed to 16,209 results for: GRN;
-
-
-
-
-
gh129
Plasmid#106799Purposeexpression of gRNA targeting CSGALNACT1DepositorInsertCSGALNACT1 (CSGALNACT1 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
LRG-2.1T-sgTAF12(human)#4.5
Plasmid#105987Purposelentivirally express gRNA targeting human TAF12 HFD with GFP markerDepositorInsertgRNA targeting human TAF12-HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG-neo-sgTAF12(mouse)#4.1
Plasmid#105588Purposelentivirally express gRNA targeting human TAF12 HFD with GFP marker and neo resistanceDepositorInsertgRNA targeting TAF12 HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.4
Plasmid#78539PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.3
Plasmid#78538PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.3
Plasmid#78542PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.2
Plasmid#78537PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNA0304
Plasmid#165612PurposeVector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)DepositorInsertSNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
UseCRISPRExpressionYeastMutationNotI site replaced the CAN1 spacer in parent vect…PromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pDG462
Plasmid#100903PurposeSpCas9n (D10A Nickase mutant) with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG461
Plasmid#100902PurposeSpCas9n (D10A Nickase mutant) with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-EGFPExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
