We narrowed to 10,433 results for: yeast
-
Plasmid#110664PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU30.2-2.2
Plasmid#110663PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4
ExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-Lam
Plasmid#133902PurposeNegative control when used in combination with pAWH-largeT. Expression of Gal4BD-Bait hybrid protein. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pYG026
Plasmid#65328Purposereporter plasmids used in YeastFab work, in which promoters could be inserted just upstream YFP(YEVenus) to drive its expression, also contains an mCherry gene driven by TEF2 promoter.DepositorInsertccdB
UseUnspecifiedAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DB
Plasmid#215482PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT (DVD)
Plasmid#184316PurposeTo study dynamics of G-actin using NMR spectroscopy.DepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-K2-L2
Plasmid#80684PurposeGateway Entry vector containing a temperature-sensitive mouse DHFRDepositorUseSynthetic BiologyTags3xHAExpressionBacterial, Insect, Mammalia…Mutationmouse DHFR with N-terminal UbiquitinAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-DENV_NS3-GS-NS2B
Plasmid#201940PurposeExpresses DENV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-WNV_NS2B-GS-NS3
Plasmid#203475PurposeExpresses WNV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-KUNV_NS2B-GS-NS3
Plasmid#203506PurposeExpresses KUNV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorInsertKUNV NS2B-GS-NS3
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBGE3.0
Plasmid#165988PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Nm/Kan resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
neomycin resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HAV_3C
Plasmid#203481PurposeExpresses HAV 3C protease from a GALL promoter with a URA3 markerDepositorInsertHAV 3C protease
ExpressionYeastPromoterGALLAvailable SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBGE1.0
Plasmid#165986PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Spec resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
spectinomycin/streptomycin resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCHKU38.2-2.2
Plasmid#110670PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4, S_paradoxus_ADH2-ORF5, S_kudeiaveseii_ADH2-ORF6, ICL1-ORF7
ExpressionYeastAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJTB126
Plasmid#248910Purposeexpresses the yeast analog-sensitive Smk1-Q120A and Ssp2 fused to glutathione-S-transferase in bacteriaDepositorInsertsSMK1 Mitogen-activated Protein Kinase -analog-sensitive form (SMK1 Sequence is from the SK1 isolate of S. cerevisiae and will differ by 1 non-synonomous/several synonymous changes from S288C form, Budding Yeast)
Ssp2 Activator of the Smk1 MAPK (SSP2 Sequence is from the SK1 isolate of S. cerevisiae and may differ by synonymous changes from S288C form, Budding Yeast)
Tagsglutathione-S-transferaseExpressionBacterialMutationcodon 120 has been changed from Q to A (Smk1-Q120…PromoterT7Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5738
Plasmid#249324PurposeTo express the EPEC DarT2(DLAA)-nScCas9(D10A) fusion protein in experiments for Append EditingDepositorInsertEPEC DarT2(DLAA)-nScCas9(D10A)
ExpressionYeastMutationDarT2(G49D, M86L, R92A, R193A) and nScCas9(D10A)Available SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5753
Plasmid#249325PurposeTo express the EPEC dDarT2(DLAA)-nScCas9(D10A) fusion protein in experiments for Append EditingDepositorInsertEPEC dDarT2(DLAA)-nScCas9(D10A)
ExpressionYeastMutationDarT2(G49D, M86L, R92A, E,170A, R193A) and nScCas…Available SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC[∆2-83]-His+MFN2-Strep (SB259)
Plasmid#227608PurposeInducible coexpression of His-tagged SLC25A46 in its N-terminal region (∆2-83) and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM]-Strep (SB260)
Plasmid#227609PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-544, 651-757 only [TM deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:K2P2.1(mTREK-1)Cryst S112C
Plasmid#224780PurposePichia pastoris expression vector for generating mouse TREK-1(21S-322T) + 3C cleavable site + eGFP + 10x His under the AOX1 promoterDepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
ExpressionYeastMutationK84R / Q85E / T86K / I88L / A89R / Q90A / A92P / …PromoterAOX1 promoterAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-CV-B3_3C
Plasmid#203499PurposeExpresses CV-B3 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-POWV_NS2B-GS-NS3
Plasmid#203471PurposeExpresses POWV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-LGTV_NS2B-GS-NS3
Plasmid#203468PurposeExpresses LGTV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SHV_3CL
Plasmid#203473PurposeExpresses SHV 3CL protease from a GAL10 promoter with a URA3 markerDepositorInsertSHV 3CL protease
ExpressionYeastPromoterGAL10Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-YES1-6stop
Plasmid#203476PurposeExpresses human YES1 kinase from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-Bat-SL-CoVZC45_PLP
Plasmid#201939PurposeExpresses Bat-SL-CoVZC45 papain-like protease from a GAL promoter with a URA3 markerDepositorInsertBat-SL-CoVZC45 PLP
ExpressionYeastPromoterGAL1Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only