We narrowed to 8,420 results for: chloramphenicol
-
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDEST-pSP172BSSPE-pFOGc::RfA-venus
Plasmid#186401PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter Venus under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::venus-RfA
Plasmid#186400PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-HA
Plasmid#186405PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-HA
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0033
Plasmid#185624PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-CTCGDepositorInsertNbU6-2
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0032
Plasmid#185623PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-TTCGDepositorInsertNbU6-1
UseCRISPR and Synthetic BiologyAvailable SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmRE-Tn5-142
Plasmid#118531PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmClover3
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_009
Plasmid#180518PurposeEmpty backbone for D1.1 cloning, contains LacZ dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_137
Plasmid#180521PurposeEmpty backbone for D1.2 cloning, contains sfGFP dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_010
Plasmid#180519PurposeEmpty backbone for D1.2 cloning, contains LacZ dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAK175
Plasmid#178601PurposepAP259 derived plasmid encoding a xylose inducible BitlucOptDepositorInsertBitlucopt
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC6-spacer
Plasmid#176178Purposeyeast MoClo level-0 part plasmid type 6 containing non-coding DNA spacer for construction of MoClo plasmids without yeast markerDepositorInsert41 bp non-coding DNA spacer from pYTK048
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-xylA
Plasmid#158611PurposeLow phosphate inducible gRNA silencing the xylA promoterDepositorInsertxylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0058
Plasmid#177022PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol 8-oxidase; geraniol-10-hydroxylase; CYP76B6
UseSynthetic BiologyAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
PROM5_MpU6
Plasmid#136120PurposeMp U6 promoter (type III RNA polymerase promoter) to drive expression of gRNA for CRISPR/Cas9DepositorInsertPROM5_MpU6
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS_Cas9-NLS
Plasmid#136121PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPRDepositorInsertCDS_AtcoCas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12_Cas9-NLS
Plasmid#136122PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPR. CDS12 for N-term fusion with a CTAGDepositorInsertCDS12_AtcoCas9-NLS(noStop)
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only