We narrowed to 9,135 results for: mel
-
Plasmid#130909PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CAG promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorHas ServiceAAV8InsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLZRS-ER-Rac1-Q61L-shortlinker
Plasmid#128584PurposeFor mammalian cell expression of Q61L mutant murine RAC1 carrying a modified hormone-binding domain of murine ERalpha at the N-terminus. Activation of expressed latent fusion protein induced by 4-OHTDepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTagsModified hormone binding domain of ER alphaExpressionMammalianMutationChanged Glutamine61 to Leucine in the RAC1 moiety.Available SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLZRS-ER-Rac1-P29S-shortlinker
Plasmid#128583PurposeFor mammalian cell expression of P29S mutant murine RAC1 carrying a modified hormone-binding domain of murine ERalpha at the N-terminus. Activation of expressed latent fusion protein induced by 4-OHTDepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTagsModified hormone binding domain of ER alphaExpressionMammalianMutationChanged Proline29 to Serine in the RAC1 moiety.Available SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-ChrimsonR-tdTomato
Plasmid#99231PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterCaMKIIAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-TP53-1
Plasmid#121917PurposeEncodes sgRNA targeting exon 4 of TP53DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
beta-catenin (S33Y)-pcw107
Plasmid#64615Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
OCT4-GFP-2A-PURO transgenic reporter
Plasmid#52379PurposeBAC recombineering generated construct, used as a reporter for OCT4 expressionDepositorInsertsGFP-2A-puro
OCT4
ExpressionMammalianPromoterOCT4Available SinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato]
Plasmid#62723PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. TdTomato is a codon diversified version.DepositorHas ServiceAAV1 and AAV5InsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
NES-mCherry-PH-BTKx2
Plasmid#183654PurposePtdIns(3,4,5)P3 biosensorDepositorInsertBTK (BTK Human, Frog)
TagsX. laevis map2k1.L(32-44)-mCherryExpressionMammalianMutationAmino acids 2-174 and 2-170PromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 HM a
Plasmid#26353DepositorInsertSox2 shRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Human, Zebrafish)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
beta-catenin (S33A, S37A, T41A, S45A)-pcw107-V5
Plasmid#64613Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUG34-NES-EGFP-cPHx3
Plasmid#183669PurposePtdIns(3,4)P2 biosensor for expression in yeastDepositorInsertPLEKHA1 (PLEKHA1 Human, Frog)
TagsX. laevis map2k1.L(32-44)-EGFPExpressionYeastMutationAmino acids 169-329 (tandem trimer)PromoterMET25Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p53 (dominant negative R175H mutant)-pcw107-V5
Plasmid#64638Purpose3rd generation lentiviral transfer plasmid. When used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only