We narrowed to 17,775 results for: STO
-
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (minus strand)
Plasmid#91840PurposeLuciferase reporter for IL2RA enhancer (IGI-P0617)DepositorInsertIL2RA CaRE6 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 C>AAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (minus strand)
Plasmid#91843PurposeLuciferase reporter for CD69 enhancer (IGI-P0620)DepositorInsertCD69 CaRE2 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_L (OZ535)
Plasmid#27212DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_R (OZ536)
Plasmid#27213DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT3EF1aH-myr-Akt
Plasmid#179909PurposeThis plasmid is in the pT3-EF1a vector without loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid can be used with Cre for in vivo studies.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-sgTrp53-sgAtrx-EFS-Cre
Plasmid#189977PurposeExpresses Cre cDNA and sgRNAs targeting murine Trp53 and AtrxDepositorInsertsgTrp53, sgAtrx, Cre recombinase
UseAAV, Cre/Lox, and Mouse TargetingAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9(LWKYQS)-P2A-EGFP (BKS1014)
Plasmid#223127PurposepCMV and pT7 Human expression plasmid for TadCBEd using SpCas9 CBE enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA-CDd-SpCas9(LWKYQS)-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9(D10A/LWKYQS)=D1135L, …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX305_FKBP12F36V-SHOC2
Plasmid#134522PurposeLentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsFKBP12F36V-2xHAExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterhPGKAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LVXN-Neo-NSD2-E1099K
Plasmid#86011Purposeexpress NSD2 E1099K mutant in mammalian cellsDepositorInsertNSD2 E1099K mutant (NSD2 Human)
TagsFlag tag D Y K D D D D KExpressionMammalianMutationE1099K; K1002R (please see depositor comments bel…PromoterCMVAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PDE4D2cat-ICUE4
Plasmid#181847PurposeICUE4 cAMP sensor tethered to the catalytic domain of PDE4D2.DepositorTagsECFP, PDE4D2(86-418), and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 nonmutant
Plasmid#183813PurposeExpress CD74-ROS1 fusion (C6;R34) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-BRD4-7D
Plasmid#90007Purposeexpresses 7D mutant BRD4DepositorInsertBRD4 (BRD4 Human)
TagsFlagExpressionMammalianMutationChanged 484S to 484D, 488S to 488D, 492S to 492D,…Available SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-BRD4-7A
Plasmid#90006Purposeexpresses 7A mutant BRD4DepositorInsertBRD4 (BRD4 Human)
TagsFlagExpressionMammalianMutationChanged 484S to 484A, 488S to 488A, 492S to 492A,…Available SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 G2032R
Plasmid#183814PurposeExpress CD74-ROS1 fusion (C6;R34) harboring ROS1 G2032R mutation in mammalian cellsDepositorUseRetroviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianMutationG2032RPromoterCMVAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNJP
Plasmid#115494PurposeExpression vector for NLS-iRFP-NLS, JNK KTR-mCherry, and mKO-MK2 in mammalian cellsDepositorTagsiRFP, mCherry, and mKOExpressionMammalianMutationmCherry S227F, mCherry G229R, mKO V211GPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MerCreMer-hygro
Plasmid#188982PurposeRetroviral expression of tamoxifen-inducible Cre recombinaseDepositorInsertTamoxifen-inducible Cre recombinase
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 L2086F
Plasmid#183816PurposeExpress CD74-ROS1 fusion (C6;R34) harboring ROS1 L2086F mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianMutationL2086FPromoterCMVAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only