We narrowed to 9,135 results for: mel
-
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C S222A
Plasmid#89718PurposeLentiviral gene expression vector for doxycycline inducible MEF2C-S222A expressionDepositorInsertMEF2C (MEF2C Human)
UseLentiviralExpressionMammalianMutationChanged serine 222 to alanineAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M4/X184PG-IRES(isoform 2)
Plasmid#99568Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M3/Y92C-IRES(isoform 2)
Plasmid#99567Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 2)
Plasmid#99566Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 2)
Plasmid#99565Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-PuroR [M1G]
Plasmid#171813PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES_Tomato MEF2C S222D
Plasmid#107231PurposehMEF2C phosphomimetic obtained from Quikchange Lightning MutagenesisDepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 1)
Plasmid#99560Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 1)
Plasmid#99559Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPLD
Plasmid#195479PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 88 - 310 (the resulting pyrin protein lacks the Phosphorylated Linker Domain domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 88 - 310 (the resulting pyri…Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG_Sr1644-1Sh
Plasmid#164087PurposeExpresses pGGG_Sr1644-1Sh in plantsDepositorInsertpGGG_Sr-1644-1Sh
TagsnoneExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-PuroR [M1G]
Plasmid#171803PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only