We narrowed to 19,262 results for: Tat
-
Plasmid#205149PurposeOverexpress DAG1DepositorInsertDystroglycan 1 (DAG1 Human)
UseLentiviralExpressionMammalianMutationCarries common missense variant c.41C>G (p.Ser…PromoterEF-1aAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA1
Plasmid#166913PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.2
Plasmid#196682PurposeRep/Cap plasmid for the production of M.Mus.2, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationREQQKLW insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LAG3-Fc(DAPA)-AviTag-6xHis
Plasmid#156850PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertLAG3 (LAG3 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-UNC5B-Fc(DAPA)-AviTag-6xHis
Plasmid#156795PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertUNC5B (UNC5B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD5-Fc(DAPA)-AviTag-6xHis
Plasmid#156793PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD5 (CD5 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ISLR2-Fc(DAPA)-AviTag-6xHis
Plasmid#156915PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertISLR2 (ISLR2 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-079:DCP1A-mEGFP
Plasmid#193922PurposeHomology arms and mEGFP-SRA for N-terminus tagging of human DCP1ADepositorInsertDCP1A Homology Arms with mEGFP-SRA (DCP1A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerMutationhomology arms contain point mutations to disrupt …Available SinceDec. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pD649-HAsp-LAIR1-Fc(DAPA)-AviTag-6xHis
Plasmid#156536PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertLAIR1 (LAIR1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 P311PP
Plasmid#184625PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 P311PP expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 P311PP (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationP311PPPromoterTRE promoter, Tet ONAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE-P48R-UGI
Plasmid#161817PurposeExpresses ABE-P48R-UGI in mammalian cellsDepositorInsertbpNLS-TadA7.10(P48R)-32AA linker-hSpCas9n(D10A)-10AA linker-UGI-10AA linker-UGI-bpNLS-P2A-EGFP-NLS
UseCRISPRExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…Available SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A
Plasmid#159167PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A
TagsSV40 NLSExpressionYeastMutationMutated Met 7 of the cyt b562 module of nuc-yHS1 …PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKT-mIDH1(R132H)-Myc-FLAG-IRES-Kat
Plasmid#133779PurposeExpresses IDH1 with a R132H mutation and has Myc and FLAG tags. IDH1(R132H) also has a katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (IDH1 Human)
TagsMyc and FLAGExpressionMammalianMutationArginine is mutated to histidine at amino acid po…Available SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDM304_DPAKa(GBD)-YFP
Plasmid#128699Purposeexpression of YFP-tagged probe for active Rac1 in Dictyostelium discoideum cellsDepositorInsertGBD domain (aa 731-890) of DPAKa
UseDictyostelium discoideum expression vectorTagsYFPMutationnoneAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mCherry-CyrCR1.mutant
Plasmid#128746PurposeExpresses mCherry in mammalian cells. ~200 nt of Cyrano with 5 point mutations in miR-7 site inserted in mCherry 3'UTR.DepositorInsertCyrano conserved region (CR1) with mutant miR-7 site (OIP5-AS1 Human)
ExpressionMammalianMutation5 point mutations disrupting the miR-7 sitePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
mVenus-proα2(I)-G610C
Plasmid#119839PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and mVenus between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagsmVenusExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 RNAi resistant
Plasmid#118347PurposeThis plasmid expresses RNAi resistance version of hHSF1 to use for rescue experiments with HSF1 shRNA vector (plasmid #118345).DepositorInserthHSF1 (HSF1 Human)
Tagsmyc and 6xHISExpressionMammalianMutationRNAi resistance mutations (does not change amino …Available SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-RVR
Plasmid#108861PurposeLbCpf1 Gateway entry plasmid with G548R, K554V and Y558R mutationsDepositorInsertLbCpf1-RVR (LbCpf1 with G548R, K554V and Y558R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationG548R, K554V and Y558R, Cpf1 is rice codon optimi…Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-CenpB 1-166-dCEN- Incenp-GFP
Plasmid#108484Purposeinducible expression of vsv-CenpB-1-166-dCEN-INCENP-EGFPDepositorInsertCenpB-dCEN-INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationCEN box replaced by CenpB 1-166PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only