We narrowed to 26,496 results for: vit;
-
Plasmid#192439PurposeEncodes mCherry-tagged Rheb lacking residues 38-42.DepositorInsertmCherry-Rheb(C181S) (RHEB Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationRheb amino acids 38-42 deleted.PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
OmpA-mNG-mCh
Plasmid#124216PurposePeriplasmic OM bound mNeongreen mCherry tandem, ~16 % energy transfer. pNM004 - pTHV037-OmpA-SA1-177-(SA-1)-LEDPPAEL-mNG-mChDepositorInsertOmpA-mNG-mCh
ExpressionBacterialAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SENP8 (full length))
Plasmid#16361DepositorInserthuman SENP8 full length (SENP8 Human)
TagsHisExpressionBacterialMutationhuman SENP8 full length, see Depositor CommentsAvailable SinceDec. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
eNme2-C TadDE
Plasmid#193842PurposeExpress TadDE (with eNme2-C variant) in mammalian cellsDepositorInserteNme2-C TadDE
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-KLF7-200-GFPfr1
Plasmid#169799PurposeTHe donor vector for the KLF7 gene locus.DepositorInsertDonor sequence to KLF7 neighbouring region for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted the sequence …Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
paGFP-HRas
Plasmid#18693DepositorInsertH-Ras (HRAS Human)
Tagsphotoactivatable GFPExpressionMammalianMutationA206K mutation in paGFPAvailable SinceJuly 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-TRE-mCherry-attB53
Plasmid#183611PurposeRMCE vector to shuttle puromycin resistance and TRE-mCherry cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorInsertTRE-mCherry
UseRmcePromoterTREAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn-Gβγ-BERKY1
Plasmid#158429PurposeBRET biosensor for detection of free Gβγ in lentiviral vector pLenti-hSynDepositorInsertLyn11-Nluc-ER/K linker-YFP-GRK3ct
UseLentiviralExpressionMammalianPromoterhSynapsinAvailable SinceSept. 17, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2-PLK1-mCherry
Plasmid#127154PurposeExpresses mCherry PLK1 in mammalian cells and zebrafish embryosDepositorAvailable SinceJune 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
GFP-GLT1b
Plasmid#162516PurposeRat GLT-1b cDNA N-terminally tagged with EGFPDepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
GR A458T
Plasmid#133410Purposeoverexpression of a mutant human glucocorticoid receptor in mammalian cellsDepositorAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 V5 His-TOPO-GluCl optalpha-mYFP L9'F (Opt α-GluClv2.0)
Plasmid#47387Purposeallow pharmacologically induced silencing of electrical activity in CNS neurons upon exposure to the anthelmintic drug ivermectinDepositorInsertglutamate-gated chloride Channels
ExpressionMammalianMutationLeu9 prime mutated to F (Phenylalanine in M3-M4 l…PromoterCMVAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-PpAPOBEC1 H122A
Plasmid#138338PurposeMammalian expression plasmid for BE4-PpABOBEC1H122ADepositorInsertBE4-PpAPOBEC1 H122A
UseSynthetic BiologyTagsBP-NLSMutationChange of His122 to Ala.PromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-1
Plasmid#74960PurposeCas9 + sgGFP-1 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
mcherry-Myo 9b R1695M
Plasmid#134958PurposeExpression of rat Myo 9b (Myr 5) in mammalian cells.GAP minus mutant.DepositorInsertMyo 9b (rat) with 3' UTR. GAP minus mutant R1695M (Myo9b Rat)
TagsmcherryExpressionMammalianPromoterCMV IEAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-LOx-IRES-EGFP
Plasmid#166877PurposeExpress the bacterial lactate oxidase (LOx) enzyme in mammalian cellsDepositorInsertLactate oxidase
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AktAR-Kras
Plasmid#123357PurposeFRET-based biosensor for monitoring Akt activity in non-raft plasma membrane regions.DepositorInsertAktAR-Kras
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only