We narrowed to 11,999 results for: SHA
-
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII R175/6E-Cas9n-UGI
Plasmid#119142PurposeBase editor made from APOBEC3H Haplotype II RNA binding mutant RR175/6EEDepositorInsertAPOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
UseCRISPRMutationA3H Hap II RR175/6EEPromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Anti-Sense
Plasmid#124438PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pProEx-Htb-cytATL2(R323Q)-6Gly-sfGFP
Plasmid#124066PurposeE. coli. exp. and purif. of X. laevis cytATL-R232Q fragment fused to GFP in c-terminus.DepositorInsertcytATL-R232Q-sfGFP
TagssfGFPExpressionBacterialMutationR232QPromotertrcAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Sense
Plasmid#124437PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Sense
Plasmid#124441PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Anti-Sense
Plasmid#124442PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-V111FL114FI766F-HA-TagBFP
Plasmid#120911PurposeExpresses BFP tagged Ptch1-B (V111FL114FI766F)DepositorInsertPtch1 (Ptch1 Mouse)
TagsHA and TagBFPExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, Y…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-V111FL114FW115A-HA-GFP
Plasmid#120908PurposeExpresses Ptch1-B (V111FL114FW115A)DepositorInsertPtch1 (Ptch1 Mouse)
TagsGFP and HAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-I766FV111F-HA-GFP
Plasmid#120907PurposeExpresses Ptch1-B (I766FV111F)DepositorInsertPtch1 (Ptch1 Mouse)
TagsGFP and HAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-Y233C-HA
Plasmid#120904PurposeExpresses Ptch1-B (Y233C) for function assaysDepositorInsertPtch1 (Ptch1 Mouse)
TagsHAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, Y…PromoterCMVAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-L234C-HA
Plasmid#120905PurposeExpresses Ptch1-B (L234C)DepositorInsertPtch1 (Ptch1 Mouse)
TagsHAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, L…PromoterCMVAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only