We narrowed to 82,350 results for: MYC;
-
Plasmid#39295DepositorInsertKanR
UseYeast genomic targetingTags3HA, A. gossypii translation elongation factor 1a…Available SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-mEGFP-dspB(E184Q)-6xHis
Plasmid#176573PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184QPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVDM1001
Plasmid#134660PurposeCRISPR delivery and repair template delivery vectorDepositorInsertCRISPR guide RNA array
ExpressionBacterialAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TET3G-T2A-Puro
Plasmid#158067PurposeEncodes the Tet3G transactivator and puromycin resistance.DepositorInsertpCAG-TET3G-T2A-Puro
UseAAVTagspuromycin reistance geneExpressionMammalianPromoterpCAGAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZH82 pET28a-Rai1
Plasmid#231651PurposeBacterial expression vector expressing yeast S. cerevisiae rai1, no tagDepositorInsertrai1 (RAI1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pErbB2-ECFP
Plasmid#66945PurposeMammalian expression of rat ErbB2 tagged with ECFPDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR R4-vas2-integrase-R3
Plasmid#62299PurposephageC31 integrase-expressing helper plasmid for Anopheles transgenesis, vasa promoterDepositorInsertphageC31 integrase under control of vasa promoter and terminator
TagsHA and SV40 NLSExpressionInsectPromotervasaAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTopo_Ex2Donor_pPGK-PURO
Plasmid#198862PurposeDonor template for CRISPR/Cas9 targeting of TERT Ex2DepositorInsertPURO
ExpressionMammalianPromoterPGKAvailable SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pME-Gal80ts
Plasmid#51619Purposevertebrate expression of full-length temperature-sensitive Gal80 with stopDepositorInsertGal80ts (GAL80 Budding Yeast)
UseVertebrate expressionMutationtemperature sensitive (G203V, G323R)*Available SinceMarch 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
LT2_7_OxPro
Plasmid#177709PurposePlasmid for genome integration in X2 site expressing OxPro (oxidative stress biosensor)DepositorInsertspTRX2_5xUAS-ymYPET-tCYC1
pTEFmut8-mCherry-tADH1
UseUsed as donor dna in genome integration after lin…ExpressionYeastAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Plasma membrane-targeted optodPLD
Plasmid#140061PurposeEncodes CRY2-mCherry-dPLD-P2A-CIBN-CAAX for mammalian expressionDepositorInsertPhospholipase D
TagsCAAX, CIBN, CRY2, P2A, and mCherryExpressionMammalianMutationH170A (catalytic dead)Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-JNKAR1
Plasmid#61625PurposeFRET-based biosensor for monitoring JNK activityDepositorInsertJNKAR1
TagsCitrine and ECFPExpressionMammalianPromoterCMVAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT45
Plasmid#223417PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for dicot plants; TTTV PAM; LbCas12a-D156R and the crRNA was driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH183_MS2-AIDΔDead-Hygro
Plasmid#85414Purposelentiviral expression vector for MS2-AIDΔDead fusion protein with hygromycin B selectable markerDepositorInsertMS2-AIDΔDead and Hygromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT60
Plasmid#223432PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT61
Plasmid#223433PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS178
Plasmid#215678PurposeEmpty repair plasmid for ChrII split hygromycinR landing padDepositorInsert5'HA + MCS + loxP + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGDP1 vph
Plasmid#112893PurposeThis plasmid is part of the Minimal Antibiotic Resistance Platform (ARP) Kit (Addgene #1000000143). Low copy-number plasmid that constitutively expresses genes using the Pbla promoter.DepositorInsertvph
Tags6xHisExpressionBacterialPromoterPblaAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only