We narrowed to 40,286 results for: LAT
-
Plasmid#51816PurposeExpresses full-length Receptor-type tyrosine-protein phosphatase eta precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPTPRJ (PTPRJ Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP7 CS puroR
Plasmid#46754PurposeRetroviral vector that expresses catalytically inactive form of HA-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsHAExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SERPINH1
Plasmid#155999PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PPIB
Plasmid#155838PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRPF19
Plasmid#155847PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSKC12 - DelQ
Plasmid#110493PurposeMonitor the expression of Luciferase driven by a mutated NRAS 5'-UTR.DepositorInsertNRAS 5'- DelQ (bp 30-254) (NRAS Human)
UseLuciferaseTagsFirefly luciferaseMutationDeletion of the first 29 base pairs of the NRAS 5…PromoterT7Available SinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-3myc-6His-EZH2 21A
Plasmid#42663DepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-3myc-6His-EZH2 21D
Plasmid#42664DepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
TERT
Plasmid#156078PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only