We narrowed to 29,389 results for: des.2
-
Plasmid#20104DepositorInsertGUS (gus )
UseSynthetic Biology; Plant gateway vectorAvailable SinceMarch 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_WT
Plasmid#205469PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertWildtype GATD1 Alu Domain
UseLuciferase and RNAiPromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Septin 2 -GFP
Plasmid#118734PurposeTo express Septin 2 tagged with GFP on C-terminusDepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Septin 2 -tdTomato
Plasmid#118735PurposeTo express Septin 2 tagged with tdTomato on C-terminusDepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF 3-CFP-2
Plasmid#20105DepositorInsertCFP (Cfp )
UseSynthetic Biology; Plant gateway vectorAvailable SinceFeb. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
K44A dynamin 2 pEGFP
Plasmid#34687DepositorAvailable SinceFeb. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
wt dynamin 2 pEGFP
Plasmid#34686DepositorInsertdynamin 2 (Dnm2 Rat)
TagsEGFPExpressionMammalianMutationD406G, V664A, H692R and Q758RPromoterCMVAvailable SinceFeb. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTRF4-2
Plasmid#66204Purposeexpresses EGFP-tagged TRF4-2 in Drosophila cellsDepositorAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut1
Plasmid#205470PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 1 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the entire structure of the alu domain wi…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Py-2-Cys-Prx
Plasmid#25575PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertPy-2-Cys-Prx
TagsHisExpressionBacterialAvailable SinceSept. 10, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-Vinc(2-258)
Plasmid#80025PurposeMammalian expression of mCherry-vinculin 2-258 (head)DepositorAvailable SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 2 gRNA
Plasmid#68350Purposepx330 with gRNA towards SMAD exon 2. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 2 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA1_SARS-COV-2 _NSP1
Plasmid#169376PurposeCell-free/mammalian expression vector for SARS-COV-2 virus NSP1 with N-term eGFPDepositorInsertSARS-COV-2 _NSP1
UseCell-free expression vectorTagsHis and eGFPMutationCodon optimized for Saccharomyces cerevisiaePromoterT7- CMV/CAGAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-insGFP.2
Plasmid#188029PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker insulin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; insulin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-insBFP.2
Plasmid#188008PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker insulin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; insulin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-insGFP.2
Plasmid#188011PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker insulin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; insulin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-cmlc2BFP.2
Plasmid#188020PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker cmlc2 BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; cmlc2 promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-cmlc2GFP.2
Plasmid#188023PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker cmlc2 GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; cmlc2 promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only