We narrowed to 40,286 results for: LAT
-
Plasmid#120832PurposeEctopic expression of ZIKV proteinDepositorInsertZIKV NS5-eYFP "NLS-mut"
TagseYFP-V5ExpressionMammalianMutationR372A/Q373A/K387A/H388A/K389APromoterCMVAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH732-2µ-RLuc/staCFLuc
Plasmid#40607DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)- e18 LOF
Plasmid#131729PurposeExpresses a loss of function mutant of an engineered variant of RAD18 ("e18")DepositorInserte18/D221A (Loss of function mutant of RAD18 with SAP domain deleted and UBZ point mutation) (RAD18 Human)
TagsFLAG and HAExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-mCherry
Plasmid#65283PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
UseLentiviralTagsStreptavidin Binding Protein (SBP) and mCherryPromoterCMVAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
VP-ARF
Plasmid#89122Purposemammalian expression of p14-hARF linked to VP16 activation domainDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP11 CS puroR
Plasmid#46748PurposeRetroviral vector that expresses catalytically inactive form of Flag-tagged human USP11DepositorInsertUSP11 (USP11 Human)
UseRetroviralTagsFlagExpressionMammalianMutationC318S--catalytically inactivePromoterCMVAvailable SinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX neo PFKP-GFP K281R
Plasmid#138288PurposeMammalian Expression, Lentiviral. Expression of human phosphofructokinase platelet isoform PFKP-GFP fusion protein with K281R mutationDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR KIF17 (1-738)
Plasmid#60406PurposeExpression of truncated form of human homodimeric kinesin-2 (KIF17) amino acids 1-738DepositorInsertKIF17 (KIF17 Human)
UseLentiviralTagsGB1, Strep-Tag, and sfGFPExpressionMammalianMutationTruncated version amino acids 1-738PromoterSFFVAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only