We narrowed to 33,975 results for: CMV
-
Plasmid#92366Purposeexpression of M1 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterCMVAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-FRNK
Plasmid#74481PurposeThis plasmid was constructed in order to characterize the function of Proline-rich tyrosine kinase 2 (PYK2).DepositorInsertFRNK (PTK2 Chicken)
Tagsc-mycExpressionMammalianMutationFRNK is the C-terminal, noncatalytic domain of th…PromoterCMVAvailable SinceAug. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV0-OCT-HA-eGFP
Plasmid#67479PurposeTargets HA-eGFP to mitochondrial matrixDepositorInsertOCT-HA-eGFP
ExpressionMammalianPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM1-C49,50,83,103A
Plasmid#58421PurposeExpresses murine IFITM1-C49,50,83,103A with an N-terminal HA tag in mammalian cells (cysteine-less mutant that is not palmitoylated).DepositorInsertIFITM1 (Ifitm1 Mouse)
TagsHAExpressionMammalianMutationCysteines 49, 50, 83, and 103 to AlaninePromoterCMV IEAvailable SinceSept. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K24,83,88,104A
Plasmid#58408PurposeExpresses murine IFITM3-K24,83,88,104A with an N-terminal HA tag in mammalian cells (Lysine-less nonubiquitinated mutant)DepositorInsertIFITM3 (Ifitm3 Mouse)
TagsHAExpressionMammalianMutationLysines 24, 83, 88, and 104 to AlaninePromoterCMV IEAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNCMV 16E6no* I128T
Plasmid#47706PurposeDefective for E6AP bindingDepositorInsertHPV 16 E6no* (E6 HPV)
TagsFLAG and HAExpressionMammalianMutationdel first 7 aa, I128T, V42L*PromoterCMVAvailable SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-ratERK2-Q103A
Plasmid#40816DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-M2-TLR2-V660N
Plasmid#12292DepositorInsertTLR2 (Tlr2 Mouse)
TagsFLAG (FLAG-M2)ExpressionMammalianMutationM82I, H202Y and V660N; signal peptide (aa1-23) re…Available SinceJan. 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 T45D-WPRE
Plasmid#250388PurposeLentiviral expression of human NUDT5 T45D with N-terminal mCherry seperated by a flexible GSG-linker and P2Aunder CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationT45DPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 T45A-WPRE
Plasmid#250387PurposeLentiviral expression of human NUDT5 T45A with N-terminal mCherry seperated by a flexible GSG-linker and P2Aunder CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationT45APromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-MDM2 Fusion Vector
Plasmid#237198PurposeExpress NanoLuc(R)-MDM2 Fusion Protein in Mammalian Cells under a CMV promoterDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-iGlu3Fast
Plasmid#226500PurposeUltrafast-decay iGluSnFR3 variant for tracking high frequency synaptic glutamate releaseDepositorInsertiGluSnFR3 S72T
TagsIgK, Myc tag, and PDGFR Beta TM domainExpressionMammalianMutationS72TPromoterCMVAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_SARS-CoV_S
Plasmid#207306PurposeMammalian expression of Human SARS coronavirus S proteinDepositorInsertSARS-CoV_S (S Human SARS coronavirus)
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CMP-PE-V1
Plasmid#202769PurposeExpresses CMP-PE-V1 in mammalian cells for prime editingDepositorInsertCMP-PE-V1
ExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BACH1t_RFP
Plasmid#199214PurposeBACH1 C-terminus truncated isoform - BACH1t expression plasmid with a RFP reporter on the backbone.DepositorAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_GFP10-14-SEPT7
Plasmid#180341Purposemammalian expression of human SEPT7 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-mApple
Plasmid#180323Purposemammalian expression of human SEPT9_i3 fused to monomeric AppleDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(WT)
Plasmid#182659PurposeExpresses wild-type mouse neurofilament light chain with an N-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertwild type mouse neurofilament light chain (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only