We narrowed to 24,925 results for: crispr
-
Plasmid#140101PurposeCRISPR-Cas9 Knock downDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralAvailable sinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2
Plasmid#117406PurposeSpyCas9 sgRNA 2 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct-Fok1:dCas9
Plasmid#62211PurposeExpresses Fok1:dCas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous high specificity genome engineering in Drosophila melanogaster.DepositorInsertFok1-dCas9
ExpressionInsectPromoteract5CAvailable sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF287_EFS-TiCas9-P2A-Puro
Plasmid#211646PurposeEFS-TiCas9-P2A-Puro. Tamoxifen-inducible SpyCas9.DepositorInsertTamoxifen-inducible SpyCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
dpYPQ230-D156R-CBE2
Plasmid#195368PurposedLbCas12a-D156R based cytosine base editor, hA3A/Y130F fused to the N terminal of dLbCas12a-D156R with the linker of XTENDepositorInserthA3A/Y130F-XTEN-dLbCas12a-D156R-UGI
UseCRISPR; Gateway compatible ha3a/y130f-xten-dlbcas…ExpressionPlantPromoterZmUBI1Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas12j3 VPR
Plasmid#188517PurposeExpresses FLAG tagged dCas12j3 VPRDepositorInsertdCas12j3
UseCRISPR and LentiviralExpressionMammalianMutationD413APromoterEF1aAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA pDEST40 Cas9-HMGB1
Plasmid#183195PurposeExpression cloneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHMGB1
UseCRISPRTagsCas9WTExpressionMammalianMutationn/aAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-986F (AAEL003877-dCas9-VPR)
Plasmid#183993PurposeExpresses dCas9-VPR under the Ae. aegypti polyubiquitin promoterDepositorInsertAAEL003877-dCAS9-VPR
UseCRISPRTagsdCas9-VPRExpressionInsectPromoterAAEL003887Available sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TnsC)-sgRNA_entry (CJT28)
Plasmid#181789PurposeExpresses 3-component ShCAST containing a Cas12k-TnsC fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTniQ, ShCas12k-ShTnsC
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT12)
Plasmid#181788PurposeExpresses 3-component ShCAST containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(Q147L)_g4+g10+g18
Plasmid#172316PurposeCRISPR dCas9 directly fused to a variant of bacterial DNA methyltransferase MQ1 to target CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(Q147L)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hSt3Cas9-NLS(SV40)-3xFLAG (KAC426)
Plasmid#133788PurposeCAG promoter expression plasmid for human codon optimized St3Cas9 nuclease with C-terminal NLS (SV40)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized St3Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAsCpf1GG
Plasmid#131011PurposeBackbone plasmid for generating CRISPR arrays for AsCas12a. Contains a GFP-dropout cassette and a direct repeat.DepositorInsertsdirect repeat of AsCas12a
GFP expression cassette
UseCRISPRExpressionBacterialAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0715 (pDonor_R1-57)
Plasmid#130644PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened right end. Total transposon size = 910 bp.DepositorInsertVchCAST donor DNA (short R)
UseCRISPR; TransposonExpressionBacterialAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB6682
Plasmid#106152PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6627, integration into Yarrowia lipolytica chromosomal location IntC_2, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by