We narrowed to 24,507 results for: crispr
-
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-gRNA_BbsI_CAM
Plasmid#183222PurposeLbCas12a gRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertLbCas12a guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEcCas6
Plasmid#170091Purposeexpresses E. coli type I-E Cas6DepositorInsertE. coli type I-E Cas6
TagsHisExpressionBacterialPromoterT7Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS30: pTarget(PmcCAST)
Plasmid#168163PurposeTarget plasmid containing PmcPSP1 and attachment site for PmcCAST.DepositorInsertsPAM for PmcCAST + PmcPSP1
tRNA-Val
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACTB-PQR-RFPnols-PQR-loxP-Zeo-loxP
Plasmid#121448PurposeTo make a stable human recombinant cell line; see right thumbnail map image for PQR annotationsDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFS_0143-pET30-Fusicatenibacter_saccharivorans
Plasmid#116952PurposeExpresses FsRT-Cas1-Cas2 under pT7lac promoter, encodes FsCRISPR array 1, compatible with classic acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
VKG1-gRNA-pX330
Plasmid#108671PurposeCleavage of VKG1 sequence by CRISPR/Cas9DepositorInsertgRNA for VKG1 sequence
UseCRISPRAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD55-full length
Plasmid#220874PurposeExpresses CD55 variant in mammalian cellsDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-82:SON-mEGFP
Plasmid#133964PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human SONDepositorInsertSON Homology Arms with mEGFP-linker (SON Human)
UseCRISPRTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceNov. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_Bfl-1.1
Plasmid#85536PurposeInducible expression of guide RNA (Bfl-1.1) with fluorescent GFP reporterDepositorInsertBfl1.1
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJE53
Plasmid#194153PurposesgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, KmR. Contains mrfp nontargeting control guide sequence.DepositorInsertsgRNA with mrfp control guide sequence
ExpressionBacterialPromoterJ23119Available SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ145-ZmUbi-tRNA
Plasmid#158403PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ135-tRNA2.0; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184294PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_puro-mKate-lox5171
Plasmid#162077Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable mKate2 reporter and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcCas12nHS_ABE_D3_empty
Plasmid#203809PurposePlasmid containing a CMV-driven NLS-dAcCas12n(D240)-ABE-Design3-NLS cassette and a U6-driven sgRNA_V6 cassette(containing BsaI sites for spacer insertion).DepositorInsertABE_D3
UseCRISPRPromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only