We narrowed to 41,781 results for: LAT
-
Plasmid#183774PurposeExpress GST-CBP(1603-2678) in E. coli. Purified GST-CBP(1603-2678) was used for in vitro acetylation assays.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pMXS-IRES-BLAST flag-CAD T456A S1406A S1859A
Plasmid#169826PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K, PKA, and Erk1/2 phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A S1859A; TCCC -> AGTC silent mutat…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A
Plasmid#169823PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and PKA phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A; TCCC -> AGTC silent mutations at…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1859A
Plasmid#169824PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1859A; TCCC -> AGTC silent mutations at…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV9-X1.1
Plasmid#196836Purposenon-standard AAV2 rep-AAV9-X1.1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV9-X1.1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV1.X1
Plasmid#209780Purposenon-standard AAV2 rep-AAV1-X1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV1-X1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDCAF3-IS5
Plasmid#65220PurposeExpresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.DepositorInsertsndmA
ndmB
ndmC
ndmD
gst9
chlR
UseSynthetic BiologyExpressionBacterialMutationChanged start codon from gtg to atg and Changed s…PromoterBBa_J23100Available SinceJan. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR (mut - miR-206 site)
Plasmid#62576PurposeTranslational Luciferase Reporter containing the mutated 3'UTR of RASA1. The miR-206 binding site was mutated.DepositorInsertRASA1 (RASA1 Human)
UseLuciferaseTagsNoneMutationmiR-206 binding site mutated (ACATTCCA --> AAC…Available SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_BRAF_ex15_V600E_S607S_1.8kb
Plasmid#183078PurposerAAV transfer plasmid with ITRs flanking: (1) BRAF V600E (T>A), S607S (TCC>AGT), 1.8kb homologous recombination donor template centered on BRAF exon 15 with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertBRAF Exon 15, 1.8kb homologous recombination donor, ~900 bp homology arms (BRAF Human)
UseAAV; Homologous recombination donor templateMutationV600E (T>A), S607S (TCC>AGT)PromoterNone for primary insert. PGK for puromycin resist…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBR HPV31 9E
Plasmid#221009PurposeHuman papillomavirus 31 isolate 9E, complete genome cloned in pBR322DepositorInsertHuman papillomavirus type 31 genome 9E isolate
UseCloning vectorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
(P6)RBSS5
Plasmid#251390PurposeRBS from rbcL gene; slr0090 (Synechocystis)DepositorInsertRBS S5
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P6)RBSS7
Plasmid#251392PurposeRBS originally used in pDF-lac [74]DepositorInsertRBS S7
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P2)RBSS5
Plasmid#251370PurposeRBS from rbcL gene; slr0090 (Synechocystis)DepositorInsertRBS S5
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P4)RBSS7
Plasmid#251382PurposeRBS originally used in pDF-lac [74]DepositorInsertRBS S7
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P3)syfp2
Plasmid#251374PurposeGene encoding yellow fluorescent protein variantDepositorInsertsyfp2
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P4)RBSS5
Plasmid#251380PurposeRBS from rbcL gene; slr0090 (Synechocystis)DepositorInsertRBS S5
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P6)RBSS6
Plasmid#251391PurposeSynthetic RBS used in expression in SynechocystisDepositorInsertRBS S6
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P2)RBSS6
Plasmid#251371PurposeSynthetic RBS used in expression in SynechocystisDepositorInsertRBS S6
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P4)RBSS1
Plasmid#251376PurposeSynthetic RBS based on Synechocystis ribosome 30S anti-SDDepositorInsertRBS S1
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P6)RBSS1
Plasmid#251386PurposeSynthetic RBS based on Synechocystis ribosome 30S anti-SDDepositorInsertRBS S1
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P2)RBSS2
Plasmid#251367PurposeRBS from C-phycocyanin beta gene in Synechococcus sp. PCC 7002DepositorInsertRBS S2
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only