We narrowed to 1,151 results for: αGFP
-
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
(-6kb/-207)mtH4-GFP
Plasmid#30464DepositorInsertHNF1a promoter
ExpressionMammalianMutationMutation of HNF4 binding site at 5471-5494 (Holew…Available SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-RUNX1-WT
Plasmid#194574PurposeMammalian Expression of mEGFP-RUNX1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/A1419R/S1421R/P1424Q/Y1426S)
Plasmid#155010PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/A1419R/S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/A1419R/S1421/P1424Q/Y1426S; insert codes f…PromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4-GFP-TEV-B55
Plasmid#217378Purposeexpresses GFP tagged B55 in mammalian cells; tev cleavableDepositorAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABRA1-IRES2-EGFP
Plasmid#170820Purposehuman GABAA receptors alpha1 subunit and IRES2-EGFPDepositorAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-3x-NLS-mScarlet-AMPKα2
Plasmid#192452PurposemScarlet-tagged alpha2 isoform of AMPK catalytic subunit targeted to the nucleus.DepositorInsert3x-NLS-mScarlet-AMPKalpha2 (Prkaa2 Rat)
Tags3x Nuclear localization signal (NLS) and mScarletExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
MIS18A_pLENTI-CAG-IRES-GFP
Plasmid#176996PurposeMammalian lentiviral expression vector encoding MIS18ADepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
piggyBac-rtTA (4th_Gen)-SNCA(A53T-DNAC)-sfGFP-IRES-NGN2-puro (VK_1124)
Plasmid#209081PurposeNgn2 mediated cortical neuron induction, along with SNCA(A53T)-DeltaNAC-sfGFP over-expressionDepositorTagssfGFPExpressionMammalianMutationA53T, NAC deletion (aa60-95)PromoterTRE4GAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-dsRed-UBC-GFP-W
Plasmid#24526DepositorTypeEmpty backboneUseLentiviralTagsDsRed and GFPAvailable SinceApril 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)EGFP/CMV/WPRE∆U3
Plasmid#41790PurposeLentiviral vector for CMV promoter driven expression of EGFPDepositorInsertEGFP
UseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-RUNX1-MUT
Plasmid#194575PurposeMammalian Expression of mEGFP-RUNX1 Mutant (G363Afs*229) Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCX-EGFP beta5 integrin receptor
Plasmid#14996DepositorAvailable SinceAug. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
pUC57mini ZM249M P90A _env eGFP
Plasmid#132939PurposepUC57mini ZM249M _env eGFP containing P90A mutant capsid sequenceDepositorInsertHIV-1ZM249M provirus (P90A) with env deletion, GFP
UseLentiviralMutationP90AAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABRA1(A322D)-IRES2-EGFP
Plasmid#170821Purposehuman GABAA receptors alpha1 subunit carrying A322D mutation and IRES2-EGFPDepositorInsertHuman GABAA receptor alpha1 subunit carrying A322D mutation (GABRA1 Human)
TagsIRES2-EGFPExpressionMammalianMutationchange Alanine 322 to AspartateAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-AML1/ETO-IRES-GFP
Plasmid#60832PurposeAML1/ETO9a cDNA was generated by PCR from full-length human AML1/ETO-IRES-GFP and subcloned into MSCV-IRES-GFPDepositorAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.EF1a.eGFP.WPRE.rBG
Plasmid#105547PurposeAAV expression of EGFP from EF1a promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, and AAV8InsertEGFP
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZucchini2_SFFV-RARA-eGFP-IRES-mCherry_NeomycinR
Plasmid#247925PurposeOverexpression vector for eGFP tagged RARA or NR1B1. Monitor post-translational degradation of RARA via EGFP:mCherry ratio. Contains neomycin-resistance selection marker.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only