-
Plasmid#149363PurposeAAV-mediated and Cre-dependent expression of tTA under the CAG promoter.DepositorInserttTA2
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18
Plasmid#68827PurposeExpresses c-myc-tagged human RAD18DepositorInsertc-myc tagged human RAD18 (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
UseTagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
UseTagsExpressionPlantMutationPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GFP
Plasmid#11153PurposeMammalian expression vector for expression of GFP (CMV promoter)DepositorHas ServiceCloning Grade DNAInsertCMV promoter-EGFP
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCralbp-DsRed
Plasmid#11158DepositorInsertCralbp promoter (Rlbp1 Mouse)
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedTagsExpressionBacterialMutationPromoterAvailable sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseTagsExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiTagsExpressionMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
BLBP-mCherry
Plasmid#63721PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorInsertBLBP (Fabp7 Mouse)
UseTagsExpressionMammalianMutation1700 bp upstream of BLBP gene cloned in CAG-mCher…Promoter1700bp upstream of BLBP geneAvailable sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dSAP
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only