We narrowed to 7,476 results for: addgene/1000
-
Plasmid#134252PurposeLentivector encoding CRISPR-resistant skywarp form of Snrnp40 (missing exon 5)DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationdeleted amino acids 179-219, and mutated coding s…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
RN3P-KDM5B-FLAG
Plasmid#86398PurposeFLAG-tagged mouse KDM5B cDNA clone for mammalian cell expressionDepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_OMA1_WT
Plasmid#81889PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_OMA1_p.P177S
Plasmid#81441PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#2/Cre
Plasmid#193204PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#1/Cre
Plasmid#193203PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20_mStrawberry_Atg4BC74A
Plasmid#161735PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mStrawberry to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmStrawberryExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_Hyg_mTurquoise2_Atg4BC74A
Plasmid#161733PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mTurquoise2 to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmTurquoise2ExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-1#
Plasmid#234765Purposeknockout Crls1DepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-2#
Plasmid#234766Purposeknockout CrlsDepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-GFP
Plasmid#66080PurposeThis G protein alpha-q construct contains internal insertions of GFP and the EE epitopeDepositorInsertG protein alpha-q-EE-YFP (Gnaq Mouse)
TagsGFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
Anti-Mitofusin-1 [N111/24R]
Plasmid#140072PurposeMammalian Expression Plasmid of anti-Mitofusin-1 (Mouse). Derived from hybridoma N111/24.DepositorInsertanti-Mitofusin-1 (Mouse) recombinant mouse monoclonal antibody (Mfn1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-CFP
Plasmid#66081PurposeThis G protein alpha-q construct contains internal insertions of CFP and the EE epitopeDepositorInsertG protein alpha-q-EE-CFP (Gnaq Mouse)
TagsCFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7a
Plasmid#160102PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7_R505C
Plasmid#160104PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only