We narrowed to 13,480 results for: LIC
-
-
pTD68-rHUH
Plasmid#235194PurposeTo express rHUH-myc in bacteriaDepositorInsertrHUH
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK501
Plasmid#48107PurposelacZ promoter-probe plasmid with pVS1 origin of replication and chloramphenicol resistanceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-K27 histone methylation reporter
Plasmid#22865DepositorInsertK27 HMR
TagsCFP and YFPExpressionMammalianAvailable SinceJan. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pOpen-BsupolLF
Plasmid#165563PurposeBsu DNA Polymerase I, Large Fragment retains the 5'-3' polymerase activity of the Bacillus subtilis DNA polymerase I, but lacks the 5'-3' exonuclease domain. This large fragment naturally lacks 3'-5' exonuclease activity. Applications include random primer labeling, second strand cDNA synthesis, single dA tailing, and strand displacement DNA synthesis.DepositorInsertBsu DNA Polymerase I, Large Fragment
UseSynthetic BiologyAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCasperAUG-Gal4-X
Plasmid#8378DepositorInsertYeast Gal4 (GAL4 Budding Yeast, fused to first ~30 amino acids of Drosophila ADH)
UseDrosophila p-element vectorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pZS2oxySp*-RBS30-Bxbi-proD-oxyR
Plasmid#78211PurposeSynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
mAmetrine-tdTomato-FRET
Plasmid#58165PurposeLocalization: Cytosolic FRET, Excitation: , Emission:DepositorTypeEmpty backboneTagsmAmetrine and tdTomatoExpressionMammalianAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKDM
Plasmid#110740PurposePlasmid for the insect cell expression system, two promoters, Multiplication Module M, Tn7 transpositionDepositorTypeEmpty backboneExpressionInsectAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQUAST-frt-stop-frt-p65AD::CaM
Plasmid#64716Purposegenerating transgenic TRIC fliesDepositorInsertsp65AD::CaM
frt-stop-frt
ExpressionInsectAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
mAmetrine-mStrawberry-FRET
Plasmid#58170PurposeLocalization: Cytosolic FRET, Excitation: , Emission:DepositorTypeEmpty backboneTagsmAmetrine and mStrawberryExpressionMammalianAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
His6x-EX-HA-FRB-MBD_pYFJ16
Plasmid#120917PurposeExpresses His6-EX-HA-FRB-MBD in bacteria for protein purificationDepositorInsertHis6-EX-HA-FRB-MBD
ExpressionBacterialAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ZnRed
Plasmid#170782Purposecytosolic ZnRed zinc sensor with 166 nM and 20 uM KdDepositorInsertZnRed
ExpressionMammalianMutationK255NPromoterCMVAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
OR gate
Plasmid#44451DepositorInsertOR-gate
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
SPIN2B (SPIN2BA-c011)
Plasmid#98238PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-S28 histone 3 phosphorylation reporter
Plasmid#32788DepositorInsertCFP-14-3-3tau-H3 peptide-YFP
TagsCFP and YFPExpressionBacterialAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CERK1 D441V-YFPc-1
Plasmid#102403Purposesplit YFP. Plant expression of CERK1 D441V-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mixed-signal integration BAC Reporter
Plasmid#78223Purposesynthetic gene circuitDepositorInsertsynthetic gene circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3 delta Exon(2+3)
Plasmid#100783PurposeMammalian expression of human-BNIP3 delta Exon2+3 splice variantDepositorInserthuman-BNIP3 delta Exon(2+3) (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 and Exon3 deletionPromoterCMVAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS2katGp-RBS33-TP901-proD-oxyR
Plasmid#78215Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78217Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS2katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78213PurposeSynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2
Plasmid#39150PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
Bxbi+PhiC31 GFP Bandpass BAC Reporter
Plasmid#78218Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F7
Plasmid#234973PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F7
ExpressionBacterialAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F8
Plasmid#234974PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F8
ExpressionBacterialAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F6
Plasmid#234972PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F6
ExpressionBacterialAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH
Plasmid#235190PurposeTo display rHUH on yeast surfaceDepositorInsertrHUH
ExpressionYeastAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH(G5)
Plasmid#235188PurposeTo display rHUH(G5) on yeast surfaceDepositorInsertrHUH(G5)
ExpressionYeastAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only