We narrowed to 16,214 results for: GRN
-
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-R
Plasmid#110737PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYUU
Plasmid#159751PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-L
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgTSC2
Plasmid#128098PurposeCRISPR gRNA against human TSC2 with Cas9 from S. pyogenes and 2A-EGFPDepositorAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTUU
Plasmid#159749PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEE
Plasmid#159746PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRCA377 - pBA904 Puro-T2A-GFP CD55 CRISPRa guide 1 (pRCA360 backbone)
Plasmid#238168PurposeLentiviral CRISPR guide vector expressing CD55 targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA810 - pBA904 Puro-T2A-GFP HES7 g2 CRISPRa guide (pRCA360 backbone) 674
Plasmid#238177PurposeLentiviral CRISPR guide vector expressing a HES7 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg3_pX458
Plasmid#127338PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg4_pX330
Plasmid#127341PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgT-REX17_EF1a-Puro-T2A-BFP
Plasmid#195501PurposeLentiviral BFP expression vector bearing a sgRNA targeting the promoter of human T-REX17DepositorInsertsgRNA
UseCRISPR and LentiviralTagsBFP, Puro, and T2AExpressionMammalianAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCUU
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only