We narrowed to 7,629 results for: /1000
-
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myr-HA-mIFITM3-C71,72,105A-CLVL
Plasmid#58414PurposeExpresses murine IFITM3-C71,72,105A with an N-terminal myristoylation sequence from HIV Gag followed by an HA tag, as well as a C-terminal CaaX prenylation motif, in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
TagsHA internalExpressionMammalianMutationCysteines 71, 72, and 105 to Alanine; The sequenc…PromoterCMV IEAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-A18G-B/c
Plasmid#246715PurposeEntry plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites (MIR390a Mustard Weed)
UseGateway CloningAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA
Plasmid#246243PurposeCre dependent flag-tagged Rpl22l1.DepositorInsertRpl22l1 (Rpl22l1 Mouse)
UseAAVTagsMyc-FLAG-T2A-tdTomatoExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-shMfn1-mCherry-CAAX
Plasmid#228740PurposeMembrane-tethered mCherry shRNA targeting Mfn1DepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_STAT1-2_Mutant
Plasmid#194189PurposeIncludes the promoter (1kb) of SMTS with mutated STAT1/2 binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated STAT1/2 site, Region 653-673nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV mCgrrf1-V5
Plasmid#175128PurposeLentiviral expression of mouse Cgrrf1-V5DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Mouse, Budding Yeast, Synthetic)
UseSynthetic BiologyExpressionYeastPromoterGAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-RNF68 [dRING]
Plasmid#126549PurposeExpresses FLAG-HA-tagged RNF68 [dRING mutant] in mammalian cellsDepositorInsertRNF68 (PCGF1 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationRING domain deletion mutant [dRING mutation is a …PromoterLTRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-RNF68 [Y252D]
Plasmid#126550PurposeExpresses FLAG-HA-tagged RNF68 [Y252D] mutant in mammalian cellsDepositorInsertRNF68 (PCGF1 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationY252D point mutantPromoterLTRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRA/PINCO
Plasmid#108938PurposeRetroviral expression of mRIN2 dRADepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RA domain (aa 751-836)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRHVPS9/PINCO
Plasmid#108939PurposeRetroviral expression of mRIN2 dRHVPS9DepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RHVPS9 domain (aa 455-738)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-Fc-His
Plasmid#72080PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-AP-His
Plasmid#71954PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only