We narrowed to 9,360 results for: CAG
-
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145885)
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001146307)
Plasmid#77085Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001148929)
Plasmid#77086Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001147559)
Plasmid#78005Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001487102)
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001146491)
Plasmid#77323Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001149189)
Plasmid#77514Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NLS/NES-mut
Plasmid#42002DepositorInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationR930A, R931A, R932A, R934A, F951A, F955A, I958A, …PromoterCMVAvailable SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E3B
Plasmid#157783PurposeExpresses a sgRNA targeting the 3rd exon of human FMR1 geneDepositorAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147797)
Plasmid#80204Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBub1
Plasmid#160948PurposeBub1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL2
Plasmid#106107PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL2DepositorInsertgRNA targeting ELAVL2 (ELAVL2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
STK33 gRNA (BRDN0001149402)
Plasmid#76984Purpose3rd generation lentiviral gRNA plasmid targeting human STK33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only