We narrowed to 10,841 results for: esp
-
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d
Plasmid#183516PurposeMammalian cell expression of SARS-CoV-2 Spike protein S-GSAS-rS2d with (682-685) furin side replaced with GSAS and mutation S383C, D985CDepositorInsertrS2d (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 1 DO
Plasmid#172721PurposeEncodes a sfGFP dropout expression cassette in place of Part 1 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part-5 DO
Plasmid#172725PurposeEncodes a sfGFP dropout expression cassette in place of Part 5 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 3 DO
Plasmid#172723PurposeEncodes a sfGFP dropout expression cassette in place of Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part-4 DO
Plasmid#172724PurposeEncodes a sfGFP dropout expression cassette in place of Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1049-pAAV-mscRE13-minBGpromoter-tTA2-WPRE-hGHpA
Plasmid#163482PurposeDirect-expressing tTA2 AAV Virus. Alias: AiP1049 - pAAV-AiE2013m-minBG-tTA2-WPRE-HGHpADepositorInserttTA2
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (minus strand)
Plasmid#91840PurposeLuciferase reporter for IL2RA enhancer (IGI-P0617)DepositorInsertIL2RA CaRE6 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 C>AAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only