We narrowed to 7,844 results for: amph
-
Plasmid#132712PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Pdyn geneDepositorInsertshDyn(2) (Pdyn Rat)
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-c
Plasmid#53070Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-c
Plasmid#53076Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-c
Plasmid#53068Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-c
Plasmid#53066Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shDyn1
Plasmid#132711PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Pdyn geneDepositorInsertshDyn(1) (Pdyn Rat)
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-n
Plasmid#53069Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-n
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
UseTagsExpressionBacterialMutationPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
UseTagsExpressionMutationPromoterNoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
UseTagsExpressionPlantMutationPromoter35S and NoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
UseTagsExpressionMutationPromoterNoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
UseTagsExpressionPlantMutationPromoter35S and NoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIA123
Plasmid#234038PurposeE. coli-C. difficile shuttle vector for CRISPR editing in C. difficile. Pxyl::Cas9-opt Pgdh::sgRNA-cdr_0985. PstI site to add DNA for homology directed repair. MscI and NotI for replacement of sgRNA.DepositorInsertsCas9
sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterPgdh and PxylAvailable sinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-Hsp70-zCreI-mTagBFP2d-2xins (JDW 1002)
Plasmid#229817PurposeA gateway compatible Tol2 destination vector containing the Hsp70 promoter driving Cre and TagBFP followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA-2xIns-fli1ep-zCreI-BFP (JDW 1218)
Plasmid#229819PurposeA gateway compatible Tol2 destination vector containing the fli1a promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-hsp70-zCreI-BFP (JDW 1184)
Plasmid#229831PurposeA gateway compatible Tol2 destination vector containing the hsp70 promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
SS-Myc-HexaPro-Foldon (MTK 3a) (pZYW077)
Plasmid#194233PurposeMammalian Toolkit part 3a encoding Jason McClellan lab's 6-proline Spike extracellular domainDepositorInsertCD8a Signal Sequence-Myc Tag-SARS-CoV-2 Spike1-1258 (S Synthetic)
UseSynthetic BiologyTagsExpressionMutationPromoterNoneAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only