We narrowed to 370 results for: gag pol
-
Plasmid#22500DepositorInsertgag, pol, tat, rev
ExpressionMammalianAvailable SinceMarch 12, 2010AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_6_002
Plasmid#167348PurposeddPCR gating control for droplets containing either gag+5'pol targets OR 3'pol+tat targetsDepositorInsertpol_gag_tat
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8.91
Plasmid#187441PurposeLentiviral packaging plasmid expressing gag and pol.DepositorInsertsUseLentiviralAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-CD8a/d2eGFP-IRES-Nef
Plasmid#126552PurposeReplication incompetent HIV with H13L Tat and d2eGFP/CD8a reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsCD8a and GFPMutationDelta gag/polPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCD/NL-BH*deltavpu/RT-
Plasmid#136985PurposeSecond-generation lentiviral packaging plasmid lacking reverse transcriptase activityDepositorInsertHIV-1 Gag, Pol (Integrase), Tat, Rev, Vpr, Vif
ExpressionMammalianMutationcarries D110E mutation in the reverse transcripta…Available SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CTE-Luc
Plasmid#60881PurposeReporter construct to study unspliced RNA export. Coding sequence of luciferase gene was sandwiched between 5' and 3' splice site sequences originating from the HIV gag/pol gene followed by CTEDepositorInsertLuc-CTE
ExpressionMammalianAvailable SinceJan. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSIV-D3psi/delta env/delta Vif/delta Vpr
Plasmid#132928PurposeProduction of SIV-VLPs containing Vpx proteinDepositorInsertGag, pol, and vpx
UseLentiviralAvailable SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
HIV-1 LTR-gfp
Plasmid#115809PurposeHIV-1 LTR driven reporter vector that retains complete LTRs, tat, and rev, but has a frameshift mutation in env, an ngfr reporter gene in place of nef, and gfp in place of gag, pol, vif, and vprDepositorInsertgfp and ngfr
UseLentiviralPromoterHIV1 LTRAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28a_6H-MMLV_RT_D524N-6H
Plasmid#166945PurposeBacterial expression of M-MLV reverse transcriptaseDepositorInsertgag-pol
Tags6X HisExpressionBacterialMutationD524N, H8YPromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q67H/N74D
Plasmid#217442PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q67H/N74D mutations in capsid (CA Q67H/N74D).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSRP-mTAZ
Plasmid#31795DepositorInsertTAZ
UseRNAi and RetroviralPromoterRNA Pol-IIIAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTS1108_Tier3(Lenti_inverse)
Plasmid#169663PurposeTier-3 vector for stable integration of up to three cassettes via lentiviral transduction in inverted direction with polyA (PCMV-5'LTR-Psi-gag-env-A3-pA::A2-pA::A1-pA-WPRE-3'LTR)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfb13217
Plasmid#219892PurposeThe base plasmid of TUNEYALI for TF27DepositorInsertContains gRNA targeting TF27 (YALI1_E22758g) and homologous arm matching TF27
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13246
Plasmid#219917PurposeThe base plasmid of TUNEYALI for TF56DepositorInsertContains gRNA targeting TF56 (YALI1_B06110g) and homologous arm matching TF56
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-A96 ELP
Plasmid#67856PurposeGFP Fluorescent Elastin-like Polypeptide(VPGAG) with 96 ELP repeats containing Alanine guest residueDepositorInsertGFP fused to ELP (VPGAG) repeated 96 times
TagsGFP fused to N-terminal of ELPExpressionMammalianPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only