We narrowed to 78 results for: mNeptune2
-
Plasmid#223459Purposeoig-1 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pEY133
Plasmid#223480Purposesrz-45 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY130
Plasmid#223477Purposesrx-113 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY138
Plasmid#223485Purposetol-1(3k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY91
Plasmid#191084Purposeglr-4 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEY89
Plasmid#191082Purposeglc-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY93
Plasmid#191086Purposegpa-11 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY94
Plasmid#191087Purposegpa-13 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY96
Plasmid#191089Purposegpa-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY63
Plasmid#191060Purposeaqp-5 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY60
Plasmid#191057Purposeacc-2 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY77
Plasmid#191072Purposedop-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY43
Plasmid#191047Purposeeat-4(prom6-1) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY39
Plasmid#191043Purposeacr-2(2.1k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY61
Plasmid#191058Purposeacr-2(3.7k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY80
Plasmid#191075Purposeflp-18(AVA = 4.2-1k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only