We narrowed to 4,936 results for: AAT
-
Plasmid#41927DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pET28b-hTIG3-1-164
Plasmid#100724PurposeFull-length human TIG3 in E.coli expression vectorDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28b-hTIG3-1-132
Plasmid#100720PurposeExpression of N-terminal region of human TIG3 in E.coliDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E11.3 gRNA
Plasmid#90644Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E11.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-1pro
Plasmid#231149PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1proDepositorInsertTREX2 and mobile gRNA targeting NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLNRD1_35-345_eGFP
Plasmid#208881PurposeExpress eGFP-TLNRD1 lacking N and Cterm domains (TLNRD1 amino acids 35-345) in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
mito-PDCD10-mScarlet-I
Plasmid#208887PurposeExpress mScarlet-I-PDCD10 targeted to the mitochondria in mammalian cells.DepositorInsertCCM3 (PDCD10 Human)
TagsmScarlet-IExpressionMammalianMutationPDCD10 targeted to the mitonchondriaAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLNRD1_5H_eGFP
Plasmid#208861PurposeExpress eGFP-TLNRD1 5 helix bundle (TLNRD1 lacking amino acids 142-273) in mammalian cells.DepositorInsertTLNRD1 5 helix bundle (TLNRD1 Human)
ExpressionMammalianMutationDeleted amino acid 142-273Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #1
Plasmid#198762Purposeconditional knockdown of PP1CDepositorInsertshPP1C #1 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SPN_ARR N52R (Shank3)
Plasmid#175255PurposeSPN-ARR fragment with structure opening N52R mutation in EGFP backbone for mammalian expressionDepositorInsertSPN-ARR fragment with N52R mutation from SHANK3
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only