We narrowed to 2,557 results for: GCG
-
Plasmid#249234PurposeRAB23 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pYJ23-lenti-MS2-U6-NKX6.1-acti-gRNA1
Plasmid#131067PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ24-lenti-MS2-U6-NKX6.1-acti-gRNA2
Plasmid#131068PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Dlg4
Plasmid#240294PurposeKI:Gria1 Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_TP73
Plasmid#214685PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_TP73
Plasmid#214687PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
1167A
Plasmid#218233PurposeHDR plasmid for inserting Ceratitis capitata transformer female intron into the white pupae geneDepositorInsertputative metabolite transport protein
ExpressionInsectAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A2
Plasmid#188687PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9
Plasmid#153015PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPTPRD-gRNA2
Plasmid#249226PurposePTPRD CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dUG-DH1
Plasmid#138963PurposeUsed to edit the endogenous Drosophila kkv gene to encode a fluorescent Chitin Synthase.DepositorArticleInsertDH1 oligo
UseCRISPRExpressionInsectAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp1
Plasmid#159919PurposeMutagenesis of Vamp1DepositorInsertVamp1 (Vamp1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZNF696.1.0-gDNA
Plasmid#113773PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF696DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only