We narrowed to 927 results for: plko.1
-
Plasmid#166912PurposeLentivirus for inducible knockdown of human ARNTDepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only
-
Tet-pLKO-puro-shTAL1
Plasmid#210640PurposeKnockdown of TAL1 endogenous (3'UTR)DepositorInsertTAL1 3' UTR gRNA (TAL1 Human)
UseLentiviralAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
plko-tet-on puromycin-shMTH1
Plasmid#110918PurposeTo knock down MTH1 (Mut T Homolog 1) after addition of doxyclineDepositorInsertMTH1 (NUDT1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO shDUSP19 puro
Plasmid#87796PurposeExpresses an inducible short hairpin targeting human DUSP19 sequenceDepositorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO shMKP7.v2 puro
Plasmid#87795PurposeExpresses an inducible short hairpin targeting human MKP7 sequenceDepositorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
p38-KTR-mStrawberry reporter
Plasmid#158687PurposeThis plasmid is a p38 pathway reporter. It has CMV promoter driving the expression of p38-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
JNK-KTR-mStrawberry reporter
Plasmid#158689PurposeThis plasmid is a JNK pathway reporter. It has CMV promoter driving the expression of JNK-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-Empty
Plasmid#174175PurposeControl lentiviral vector expressing GFP under control of the human PGK promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLH-sgRNA1
Plasmid#75388PurposesgRNA1DepositorInsertsgRNA1
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-CnVA
Plasmid#24587DepositorInsertGateway(TM) cassette
UseLentiviralTagsVAExpressionMammalianAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
EFSp-GFP-Empty
Plasmid#174171PurposeControl lentiviral vector expressing GFP under control of the EFS promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEFSAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
shCTNNB1 # 2
Plasmid#42544DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-boxB-MS2-PP7
Plasmid#75397PurposesgRNA1-boxB-MS2-PP7DepositorInsertsgRNA1-boxB-MS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCTNNB1 # 1
Plasmid#42543DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
iRFP-H2A
Plasmid#158691PurposeThis plasmid encodes an iRFP fused to H2A histone nuclear marker. It has CMV promoter driving the expression of iRFP fused to H2A. It has no selection markersDepositorInsertiRFP670
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
shLacZ
Plasmid#42559DepositorInsertshLacZ
UseLentiviral and RNAiExpressionMammalianAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
PKA-KTR-mStrawberry reporter
Plasmid#158688PurposeThis plasmid is a PKA pathway reporter. It has CMV promoter driving the expression of PKA-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-TAZ
Plasmid#174176PurposeLentiviral vector to constitutively express TAZ/WWTR1 under control of the human PGK promoter.DepositorAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits