We narrowed to 10,290 results for: ADA
-
Plasmid#231713PurposeCRISPR mediated KI of BromoTag at N-terminus of BRD2-GFP-P2A-BromoTag, works well with KHC064 and KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only
-
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 C4762S (ShB-R)
Plasmid#55614PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged C4762S (catalytically inactive) HERC2 in Flp-In T-Rex cellsDepositorInsert3xFLAG tagged HERC2 (C4762S) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationC4762 mutated to serine to render HERC2 catalytic…Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPB-AMBRA1-3xFLAG
Plasmid#174159PurposePiggyBac vector to stably express 3xFLAG-tagged AMBRA1DepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-SHLD3
Plasmid#114125PurposeExpresses N-terminally tagged eGFP-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagseGFPExpressionMammalianPromoterCMV/TetO2Available SinceAug. 16, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
8024 GFP_Kras_G12C_2A_puro
Plasmid#64373PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2A oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
8027_GFP-KrasG12C_2B_puro
Plasmid#64372PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-FLAG-SHLD3
Plasmid#114123PurposeExpresses N-terminally tagged FLAG-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsFLAGExpressionMammalianPromoterCMV/TetO2Available SinceAug. 16, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpp1-is3
Plasmid#58247PurposeExpression vector producing isoform 3 derived mouse osteopontin (EGFP tagged)DepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-tdTHC
Plasmid#112621Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP G55A in Artichoke
Plasmid#169935PurposeOverexpression of BCL6-GFP G55A mutant fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HOPX
Plasmid#192923PurposeBarcoded piggybac transposon vector with Dox-inducible expression of HOPXDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
8798 GFP-KrasG12C_2B_hygro
Plasmid#64376PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with hygro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta F-Box
Plasmid#197452PurposeThe plasmid expresses F-box deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression of FBW7alpha delta-F-Box and detection by western blotting.DepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin
Plasmid#223962PurposeDual fluorescent reporter for histone H2B and for exogenous RbDepositorTagsYFP and iRFP670ExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only