We narrowed to 23,305 results for: Sis
-
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gATRIP_A
Plasmid#211537PurposesgRNA-A against ATRIPDepositorInsertsgRNA ATRIP
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12720
Plasmid#212704PurposegRNA targeting to the gene 4HPPD locusDepositorInsertgRNA targeting to the gene 4HPPD locus
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK201
Plasmid#207131PurposeType 2 ptac promoter partDepositorInsertptac promoter
ExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2 RPS28 UTR1 WT
Plasmid#203157PurposeRPS28 UTR luciferase assay plasmid (WT UTR1, sites 1 and 2)DepositorInsertRPS28 UTR (RPS28 Human)
UseLuciferaseAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB605-GBSSI
Plasmid#213867PurposeBinary vector for the expression of GBBSI fused to the sGFP in plants (for Agrobacterium-mediated genetic transformation.)DepositorInsertGRANULE-BOUND STARCH SYNTHASE I (GBSSI) (GBSS1 Mustard Weed)
ExpressionBacterial and PlantAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-GBSSI
Plasmid#213866PurposeBinary vector for the expression of GBBSI fused to the tagRFP in plants (for Agrobacterium-mediated genetic transformation.)DepositorInsertGRANULE-BOUND STARCH SYNTHASE I (GBSSI) (GBSS1 Mustard Weed)
ExpressionBacterial and PlantAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSK-Spsg
Plasmid#214351PurposeExpresses cloning backbone for SpCas9 sgRNADepositorInsertSpCas9 tracrRNA
ExpressionMammalianAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xABRE_A
Plasmid#185803PurposeA synthetic ABA signaling reporter designed by multimerization of ABRE (7bp) and its flanking sequences from the ABI1 promoterDepositorInsert6xABRE(ABI1)+-86MP+erGFP
ExpressionPlantAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPCTΩSP0021
Plasmid#187561PurposeModule for copper-inducible expression of firefly luciferase and nanoluc luciferase driven by minimal synthetic promoters with binding sites for CUP2DepositorInsertFirefly Luciferase
ExpressionPlantAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPCTΩSP0022
Plasmid#187562PurposeModule for copper-inducible expression of nanoluc luciferase and firefly luciferase driven by minimal synthetic promoters with binding sites for CUP2DepositorInsertFirefly Luciferase and NanoLuciferase
ExpressionPlantAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgCASP9
Plasmid#211525PurposeDeletes CASP9DepositorInsertsgCASP9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgFADD
Plasmid#211527PurposeDeletes FADDDepositorInsertsgPIDD
UseCRISPRExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xABRE_R
Plasmid#185804Purposea synthetic ABA signaling reporter designed by multimerization of ABRE (7bp) and its flanking sequences from the RD29A promoterDepositorInsert6xABRE(RD29A)+-86MP+erGFP
ExpressionPlantAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pkk223_RbMutY
Plasmid#210797Purposepkk223 with Rhodobacteraceae MutY insertDepositorInsertMutY (adenine glycosylase)
ExpressionBacterialAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only