We narrowed to 4,579 results for: NAP
-
Plasmid#101372PurposeName: pBluescript-LANApiΔTATA. LANApi TATA box mutation in pBluescript-LANApi,K14 (pDD2000).DepositorInsertLANApi TATA box mutation in pBluescript-LANApi,K14 (pDD2000).
UseUnspecifiedMutationLANApi TATA box mutation in pBluescript-LANApi,K1…Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDD2026
Plasmid#101369PurposeName: pCBG68-LANApiΔTATA. LANApi TATA box mutation in pCBG68-LANApi (pDD2002).DepositorInsertLANApi TATA box mutation in pCBG68-LANApi (pDD2002).
UseLuciferaseMutationLANApi TATA box mutation in pCBG68-LANApi (pDD200…AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B V304A,I367A IRES GFP
Plasmid#133821PurposeEncodes the C2B domain of synaptotagmin 1 with membrane-penetrating residue mutations V304A,I367A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationV304A, I367APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B D363,365N IRES GFP
Plasmid#133822PurposeEncodes the C2B domain of synaptotagmin 1 with calcium-coordinating ligand mutations D363,365N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD363,365NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A K189-192A IRES GFP
Plasmid#133823PurposeEncodes the C2A domain of synaptotagmin 1 with poly-lysine patch mutations K189-192A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationK189-192APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A D230,232N IRES GFP
Plasmid#133824PurposeEncodes the C2A domain of synaptotagmin 1 with calcium-coordinating ligand mutations D230,232N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD230,232NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A M173,F234A IRES GFP
Plasmid#133825PurposeEncodes the C2A domain of synaptotagmin 1 with membrane-penetrating residue mutations M173,F234A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationM173, F234APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pCRII-BbsI-sgRNAscaffold
Plasmid#159352PurposeExpression vector for a customizable guide RNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypHaloTag
Plasmid#172280PurposeCre-dependent HaloTag labeling of neuronal presynaptic terminals from the synapsin promoter.DepositorInsertsynaptophysin-HaloTag
UseAAV and Cre/LoxTagsHaloTagExpressionMammalianPromoterrat synapsinAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDC180
Plasmid#218673PurposeExpresses rat ⍺SNAP in bacteriaDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19/human IL-8
Plasmid#17610DepositorInsertIL8 (CXCL8 Human)
ExpressionBacterialAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
HS-GFP-PACT
Plasmid#105954Purposeheat shock inducible transgenesis, PACT is a centriol markerDepositorAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PPBP-bio-His
Plasmid#52074PurposeExpresses full-length Platelet basic protein precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPPBP (PPBP Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn SYP-SELF
Plasmid#158770PurposeExpression of synaptophysin 1 variant with self-cleaving c-terminal tail.DepositorInsertSynaptophysin 1-NS3/4a (Syt1 Mouse)
UseLentiviralMutationFlexible linkers, ADVVCC/QMSY cleavage siteAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#471
Plasmid#110935PurposeExpresses proteins in a subset of neurons in C. elegans, including isolated expression in the DA9 cholinergic motor neuron in the tailDepositorInsertsmig-13 promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bgh-GFP-Farpl
Plasmid#115501Purposeexpression of rat Farp1DepositorAvailable SinceDec. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn Syt1-A'Q-4xGS-NS34a-FLAG (codopt)
Plasmid#158771PurposeExpression of synaptotagmin 1 variant with self-cleaving C2 domain.DepositorInsertSynaptotagmin 1 1-NS3/4a (Syt1 Mouse)
UseLentiviralMutationFlexible linkers, ADVVCC/QMSY cleavage siteAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A3
Plasmid#132167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A3 (SLC45A3 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC45A3_STOP
Plasmid#161333PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC45A3 (SLC45A3 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only